Labshake search
Citations for New England Biolabs :
101 - 150 of 10000+ citations for Rat Heat Shock 60 kDa Protein 1 Chaperonin HSP60 HSPD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... Total of 60 ug of trypsin (mass spectrometry grade, NEB) was diluted in 25 mM NH4HCO3 and added to dried gel pieces (3x volume of the gel volume) ...
-
bioRxiv - Genetics 2023Quote: ... and 60 ng/μL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.125 µL of 60 mg/mL BSA (NEB #B9001S) with the following thermal cycle condition ...
-
bioRxiv - Genetics 2023Quote: ... and 60 ng/μL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... and 60 ng/µL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... and 60 ng/µL Proteinase K (New England Biolabs; NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... or by ribodepletion with NEBNext Human/Mouse/Rat rRNA Depletion kit followed by library construction using the NEBNext Ultra II Directional RNA-Seq protocol (New England BioLabs). Illumina 2×151 paired end reads were generated either on the HiSeq 4000 or NovaSeq 6000 sequencing platforms (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... 500ng input RNA was treated using the NEBNext Human/Mouse/Rat rRNA Depletion kit and libraries were prepared following the NEBNext Ultra II Directional RNA-Seq protocol (New England BioLabs). Paired end 2×151 bp reads were produced using the HiSeq 4000 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, E6800L) was used as described in the instructions with minor modifications ...
-
bioRxiv - Microbiology 2023Quote: ... the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, E6800L) was used as described previously (31) ...
-
bioRxiv - Microbiology 2022Quote: ... These primer pairs were assembled by heat-denaturation and annealing in Buffer 3.1 (NEB), then cloned into BbsI-linearized pX458 (62 ...
-
bioRxiv - Molecular Biology 2020Quote: ... both proteins were deglycosylated by PNGase F (NEB, 1:50) overnight at 37°C in PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... Nuclei were resuspended in 200 µL DigWash with 1:100 pA-Dam (between 20-60 New England BioLabs units, Fig. S1B) and rotated for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER product was subject to post-PCR nick sealing for 30 min at 50°C and 30 min at 60°C in a 25 μL reaction containing 1 mM β-nicotinamide adenine dinucleotide (NAD+) (NEB) and 0.5 μL HiFi Taq DNA ligase (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around rbpms2aae30 was amplified for 35 cycles with an annealing temperature of 60°C and the wild-type allele was digested with HaeIII for 1 hour (New England Biolabs, R0108S)2 ...
-
bioRxiv - Synthetic Biology 2023Quote: The cell-free protein synthesis (CFPS) reactions were carried out using the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs Inc) in 384-well plates (Thermofisher NUNC ...
-
bioRxiv - Microbiology 2023Quote: RdnE proteins were produced using the New England Biolabs PURExpress In Vitro Protein Synthesis Kit (New England BioLabs Inc., Ipswich MA). Template DNA contained the rdnE gene and required elements specified by the PURExpress kit ...
-
bioRxiv - Cell Biology 2023Quote: ... a PCR fragment containing the complete Nv-osk coding sequence was synthesized for protein expression with PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) using manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Chromatin was digested with 60 units MNase (New England Biolabs, M0247S) at 37 0C for 10 minutes and then sonicated using Branson Microtip Sonifier 450 (4X15 second at output 4.5 and duty cycle 60% ...
-
bioRxiv - Genomics 2019Quote: ... The 60 μL mix contained 6 μL of TAQ buffer (NEB), 3 μL of 5 μM forward primers mix ...
-
bioRxiv - Biochemistry 2021Quote: ... An XK 26/60 column was packed with chitin resin (NEB), and equilibrated with lysis buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... then digestion with 60 units of Mbo1 in CutSmart buffer (NEB) overnight at 37C ...
-
bioRxiv - Microbiology 2021Quote: ... we applied 60 units warm-started Bst 2.0 polymerase (NEB, M0538M) and primer extension with specific sequences (CGCTGATAAGGTCGCCATGCCTCTCAGTAC ...
-
bioRxiv - Neuroscience 2021Quote: The rat HA-tagged PRG-1 ORF construct was generated by Gibson Assembly Cloning from NEB (Ipswich, MA, #E5510S) of the Plppr4 ORF clone (NM_001001508.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... DHFR control plasmid from PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used as backbone for subsequent ligations ...
-
bioRxiv - Biochemistry 2021Quote: ... for 2 hr at 60 °C and relinearized at the basic dSpacer furan with Ape 1 (15 U; M0282S, NEB, Ipswich, MA) for 2 hr at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Immunology 2022Quote: ... U-labeled second-stranded DNAs were treated with heat-labile UDG enzyme (New England Biolabs), and ligated products were amplified with PCR by the following conditions ...
-
bioRxiv - Biophysics 2023Quote: ... followed by heat inactivation for 20 min at 80°C (Quick CIP, New England Biolabs). We added the 5’-phospho group on the synthetic parS fragment by adding a T4 kinase for 30 min at 37°C and heat-inactivated 20 min at 65°C in 1x PNK buffer supplemented with 1 mM ATP (T4 PNK ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µl of lambda protein phosphatase (New England BioLabs, Ipswich, MA). Each mixture was incubated at 30 °C for either 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μl of Lambda protein phosphatase (P0753L, New England BioLabs) were incubated with the proteins at 30°C for 30 minutes.
-
bioRxiv - Molecular Biology 2021Quote: DNAse-treated RNA with high RIN value was used to deplete ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6350) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... ribosomal RNA depletion was carried on the extracted RNA using Nebnext rRNA depletion kit (Human/mouse/rat) (New England BioLabs. In, USA). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared from RNA samples (150ng) using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB Cat# E7405) in conjunction with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB Cat# E7765) ...
-
bioRxiv - Biochemistry 2023Quote: ... An mRNA transcript library for Illumina sequencing was created using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs, Ipswich, MA). A NextSeq 500 sequencer (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... The other pCMVtag2B vectors containing different truncated versions of rat ITCH (Fig 2F) were generated via Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat#E0554S) by circularizing the PCR products amplified with the primers listed in Table S2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 16.5 µg pNIC28-Bsa4 plasmid was digested with 60 U BsaI (NEB) in 100 µL following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutant protein expression vectors were generated using the Q5 Mutagenesis Kit (New England BioLabs) and proteins overexpressed and purified the same as wild-type.
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared with NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, MA, USA; input 60 ng). Manufacturer’s instructions were followed except for Step 4 ...
-
bioRxiv - Genetics 2021Quote: ... 1 ul of 20 μM Cas protein (SpyCas9 and SauCas9 from NEB; Nme2Cas9 was purified as previously described (Edraki et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analytical amounts of twenty Argonaute proteins were synthesized from pET29a plasmids using PURExpress In Vitro Protein Synthesis kit (New England Biolabs, Inc., Ipswich, MA, USA). For large scale expression and purification of CbAgo ...