Labshake search
Citations for New England Biolabs :
401 - 450 of 2232 citations for Rat CPSF7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: Plasmid pUC19 was linearized by using restriction enzymes HindIII (NEB) and XbaI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids bearing mutations were cut with AseI (NEB, Catalog # R0526S) and SspI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... We digested the plasmid pRS31N with SacII (New England Biolabs), treated the digestion with calf intestinal alkaline phosphatase (CIP ...
-
bioRxiv - Genetics 2023Quote: ... pAAVsc-JeT-MCOLN1-pA plasmid was digested with EcoRI (NEB) to recover the ITR-flanked AAV genome to be used as standard ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pLK35 plasmids were transformed into NEB Express Iq cells (NEB) which are a bL21 derivative that constitutively expresses the lac repressor ...
-
bioRxiv - Genomics 2024Quote: ... plasmids were linearized using BamHI or NotI (New England Biolabs) and in vitro-transcribed using T7 or SP6 polymerase (DIG RNA Labeling Mix ...
-
bioRxiv - Cell Biology 2023Quote: ... and the plasmid was amplified using Q5 DNA polymerase (NEB). The template plasmid was digested with DpnI (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids were transformed into DH5a competent cells (New England Biolabs) on LB agar plates with ampicillin ...
-
bioRxiv - Cell Biology 2024Quote: ... Before transfection pKD plasmids were digested overnight with EcoRV (NEB). The enzyme was then subjected to heat inactivation for 20 min at 65 °C and then mixed with the pUF1-Cas9 plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg of replicon plasmid was linearised with AscI (NEB), purified by phenol-chloroform extraction ...
-
bioRxiv - Biophysics 2024Quote: ... The plasmid was linearized with NheI-HF (New England Biolabs) and purified using QIAquick PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Microbiology 2024Quote: ... Isolation was performed using Monarch Plasmid Miniprep Kit (NEB, UK).
-
bioRxiv - Microbiology 2024Quote: ... coli strain carrying the plasmid (Monarch Mini-Prep kit, NEB) and transformed it into electrocompetent K ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The linearized plasmid was then circularized using a KLD reaction (NEB) and transformed into competent cells via electroporation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5× Q5 buffer and pUC19 plasmid as template (New England Biolabs) in 50 μl ...
-
bioRxiv - Genetics 2021Quote: ... 20 μg of mpra:Δorf plasmid was linearized with AsiSI (NEB, R0630S) and 1x CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... plasmid pIG1783-Smkin3-gfp was used for Q5 mutagenesis (NEB biolabs). With specific primers (Table S3) ...
-
bioRxiv - Biochemistry 2022Quote: ... concentrated plasmid samples were digested by XbaI restriction endonuclease (NEB, Canada). 1 mL in vitro transcription reactions were performed using laboratory purified in-house T7 RNA polymerase and commercial RiboLock RNase inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The methylated parent plasmid was degraded with DpnI (New England Biolabs), and newly generated plasmid was transformed into OmniMAX chemically competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... RV-A16 and RV-B14 plasmids were linearized by SacI (NEB) digestion and then in vitro transcribed using HiScribe T7 Transcription Kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pMQ30MRR1-L1191H+Q1197* was digested with AscI (New England BioLabs) and AgeI-HF (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... 59.) using BbsI plasmid digest and Gibson Assembly (New England Biolabs). Spacer sequences were as follows:
-
bioRxiv - Immunology 2021Quote: ... Plasmids were transformed in E.coli DH5α competent cells (NEB; Cat,# C2987I). All site-directed changes were confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: The reporter plasmid was linearized by digesting it with PmeI (NEB) and BstXI (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... Mutated plasmids were transformed into T7 Express cells (New England BioLabs), plated on LB+100 µg/mL ampicillin agar plates and grown overnight at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid was then digested with KpnI and NcoI (NEB) for 1 hr at 37°C and ligated with hybridized primers NcoI-KpnI-link-F and NcoI-KpnI-link-R that were similarly digested ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pFETCH mutant and wildtype plasmids were SalI (New England BioLabs) digested prior to transfection to linearize the vector.
-
bioRxiv - Molecular Biology 2019Quote: ... pGP was modified from a commercially available plasmid pCMV-Gluc (NEB), in which contains a set of cellular 5’-noncoding sequences (41 nts ...
-
bioRxiv - Microbiology 2019Quote: ... and Monarch® Plasmid miniprep Kit (New England BioLabs, Ipswitch, MA) was used for purification of plasmid for gene expression and construction of deletion mutant ...
-
bioRxiv - Bioengineering 2019Quote: Single stranded plasmid master mix (3x): 3 U/µL Nb.BbvCI (NEB), 36 U/µL Exonuclease III (ExoIII ...
-
bioRxiv - Neuroscience 2019Quote: ... Using a plasmid linearized with SacI (New England Biolabs, Beverly, MA), it was transcribed with T7 polymerase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid was digested with Xba1 and Ecor1 (New England Biolabs). mCherry was amplified with a 20 bp overhang ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid act5c-Cas9 was digested with EcoRI-HF and XhoI (NEB) and the plasmid backbone was gel purified ...
-
bioRxiv - Bioengineering 2021Quote: ... digestion to remove the parental plasmid followed by NEBHiFi assembly (NEB) to assemble and seal the overlapping ends for improved transformation efficiency ...
-
bioRxiv - Neuroscience 2021Quote: ... Both plasmids were digested with SacI and PstI (New England BioLabs) to obtain fragments containing the vector backbone CD68 promoter and the DIO-eGFP insert ...
-
bioRxiv - Cell Biology 2021Quote: ... the listed plasmids were linearized using BsaBI (New England Biolabs, R0537S) and integrated at the endogenous TUB1 locus by homologous recombination.
-
bioRxiv - Biochemistry 2021Quote: This plasmid was created using NEBuilder HiFi DNA assembly protocol (NEB). In short ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were made by Gibson assembly cloning (NEB BioLabs, Ipswich, MA). Synthetic DNA fragments were obtained from IDT (Coralville ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were made by Gibson assembly cloning (NEB BioLabs, Ipswich, MA). Synthetic DNA fragments were obtained from IDT (Coralville ...
-
bioRxiv - Systems Biology 2021Quote: ... coli clones using the Monarch Plasmid Miniprep Kit (New England BioLabs).
-
bioRxiv - Microbiology 2021Quote: ... This plasmid was further modified using Q5 Site Directed Mutagenesis (NEB) to add the custom adaptors ACACTCTTTCCCTACACGACGCTCTTCCGATCT and GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Genomics 2021Quote: ... and used to assemble plasmid pools with Gibson assembly (NEB, E2611L). Pools were assembled across 16 Gibson assembly reactions (~900 ng backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... The pTRIP-Ef1α plasmid was linearized by digestion with MluI (NEB), blunted ...
-
bioRxiv - Microbiology 2021Quote: ... the CRISPRi plasmid backbone was digested with BsmBI-v2 (NEB #R0739L) and gel purified ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid DNA from single clones of transformed E.coli (New England Biolabs) was analysed for correct orientation of the insert by Sanger sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... followed by ligated to linearized plasmid using T4 DNA ligase (NEB). For site-directed mutagenesis ...