Labshake search
Citations for New England Biolabs :
251 - 300 of 9079 citations for QuantiChrom β N Acetylglucosaminidase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: The recombinant pET6xHN-N constructs were transformed into Escherichia coli strain BL21(DE3) (New England Biolabs, MA, USA). The transformed clones were cultured at 37 °C in LB medium with 100 μg/mL Carbenicillin and were induced by adding 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2023Quote: Removal of N-linked oligosaccharides in mini-procollagens was performed with PNGase F (New England BioLabs, glycerol-free). Ten micrograms of mini-procollagens were first denatured at 100 °C for 10 min in Glycoprotein Denaturing Buffer provided with the enzyme ...
-
bioRxiv - Bioengineering 2019Quote: ... mycoplasma genomes are released by digestion of the agarose matrix with three units per plug of β-Agarase I (NEB), and the DNA concentration is measured using an Epoch™ Microplate Spectrophotometer (BioTek™).
-
bioRxiv - Cell Biology 2021Quote: One plug per sample was melted at 68°C in 1 mL 100 mM MES buffer pH 6.5 prior to addition of β-agarase (New England Biolabs) and incubation overnight at 42°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 µl of the purified assembly is incubated with 50 µl of NEB 10-β-competent E.coli cells (NEB, C3019H) for 30 min at 4 ℃ ...
-
bioRxiv - Genetics 2021Quote: ... T7 endonuclease 1 assay was performed following manufacturer’s protocol (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... 5’-CTTTTGACATCCGCTTCTGC-3’ followed by a T7 endonuclease assay (NEB) to detect indels ...
-
bioRxiv - Developmental Biology 2020Quote: ... Kinase assays were performed using recombinant murine c-Abl (NEB). The amounts of GST-fusion protein to add to the reaction were calibrated using western blots of the purification products with mouse anti-NICD (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... All assays were done in Escherichia coli (strain: NEB Turbo) following the same plasmid protection assay described previously ...
-
bioRxiv - Cell Biology 2019Quote: ... Deglycosylation assay using PNGase F (P0704S, New England BioLabs Inc.) was performed according to manufacturer’s protocol with the exception of incubating the reaction for 3 hours at 37°C followed by overnight at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mutations were detected through a T7 endonuclease I assay (NEB)(76) ...
-
bioRxiv - Microbiology 2023Quote: Assays were performed using the PURExpress ΔRibosome (New England Biolabs) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... was confirmed using a Lambda phosphatase assay (New England BioLabs).
-
bioRxiv - Bioengineering 2024Quote: DNA cutting assays were performed following New England Biolabs (NEB) method.39,40 Briefly ...
-
bioRxiv - Bioengineering 2024Quote: ... The assays are composed of 1X Isothermal Buffer (NEB #B0537), 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003) ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified on the streptavidin beads using the EpiMark Hot Start Taq (New England Biolabs, Cat. N: M0490) using following program ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Biophysics 2021Quote: ... 3 mM CaCl2 and 0.02% DDM) was incubated with 2000 units of N-glycosidase F (PNGase F) (New England BioLabs) at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were resuspended in PBS and in some cases treated with N-glycosidase F (PNGase F; New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR analysis of total DNA extracted from oysters (N=60) used the high fidelity Q5 polymerase (New England Biolabs) in a total volume of 50 μL under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Cell Biology 2019Quote: ... GST:Importin-β was made by cloning Importin-β cDNA from the pEGFP-N1 vector into pGEX-4T using NcoI and NotI (New England Biolabs). The anillin constructs for mammalian cell expression (GFP-tagged ...
-
bioRxiv - Plant Biology 2019Quote: ... Expression of recombinant proteins was performed at 25°C for 4 h with 0,3 mM Isopropil-β-D-1-tiogalattopiranoside (IPTG) and affinity purification was obtained by using the amylose resin affinity matrix (New England Biolabs) in a buffer containing 60 mM HEPES-KOH pH 8.0 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 μL of this reaction mix was then used to transform 12.5 μL of chemically competent DH10-β cells (New England Biolabs, C3019) for further experiments ...
-
bioRxiv - Systems Biology 2023Quote: ... Cloning of synthetic DNA constructs was conducted using chemically competent DH10-β cells purchased from NEB (New England Biolabs, Ipswitch, MA) or XL-1 Blue (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER product was subject to post-PCR nick sealing for 30 min at 50°C and 30 min at 60°C in a 25 μL reaction containing 1 mM β-nicotinamide adenine dinucleotide (NAD+) (NEB) and 0.5 μL HiFi Taq DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pJAM2678 containing the bgaH gene encoding the β-galactosidase enzyme from Haloferax alicantei (52) was linearized using XbaI and NdeI compatible restriction enzymes (NEB) and purified from TAE agarose gels as explained previously (53) ...
-
bioRxiv - Cell Biology 2023Quote: Beads with bound Flag-RAD50 or GFP-BRCA1 were washed with 5M NaCl to eliminate contamination with protein kinases and incubated with 100 or 500 U of CK2 holoenzyme complex (α2/β; NEB) in 30 μl of kinase buffer (20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Cell Biology 2020Quote: ... photoactivatable-mCherry was PCR-amplified from the plasmid N-PA-mCh and assembled into the retroviral vector pBABE-puro using HiFi DNA Assembly (E5520S, NEB). To create the stable U2OS-dCas9-PA-mCh/GFP-Parkin and U2OS-dCas9-PA-mCh/TFEB-GFP cell lines ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Biochemistry 2019Quote: ... and cloned into a modified pOEM vector as HRV 3C-cleavable N-terminal GST fusion construct (GST-C1-GFP-NES) using the restriction enzymes NotI and AscI (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2021Quote: AcpP was expressed from a pET28a plasmid encoding acpP with a thrombin-cleavable N-terminal 6xHis tag in C3031I cells (NEB). 2L cultures of LB supplemented with kanamycin (25 μg/mL ...
-
bioRxiv - Biochemistry 2020Quote: 20 μg of protein from SK-RC-39 cells were treated with N-glycosidase F (PNGase F) and Endoglycosidase H (Endo H) (New England Biolabs) according to the manufacturer’s instructions ...