Labshake search
Citations for New England Biolabs :
401 - 450 of 1083 citations for Nucleoside diphosphate kinase A NDPKA Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... RNA samples were treated with polynucleotide kinase (New England BioLabs, Cat. #M0201) to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs ...
-
bioRxiv - Genomics 2022Quote: ... 6.5ul of T4 polynucleotide kinase 10U/μl (New England Biolabs cat. #M0201L) 1.3ul of Klenow polymerase 5U/μl (New England Biolabs cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was blunt-end repaired with T4 Polynucleotide Kinase (New England Biolabs), followed by a reaction clean-up with the MinElute purification kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... specific primers (Supplementary Table S1) were radiolabelled with T4 Polynucleotide kinase (NEB) and [?-32P]ATP (6,000 Ci/mmol) ...
-
bioRxiv - Molecular Biology 2022Quote: ... prepared by labelling of oligodeoxyribonucleotide using T4 polynucleotide kinase (New England BioLabs) and ATP or [γ32P]-ATP (Perkin-Elmer ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was then de-phosphorylated by incubating with T4 polynucleotide kinase (NEB) for 1 hr at 37° C ...
-
bioRxiv - Microbiology 2023Quote: ... by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs) at 37°C for 1 h.
-
bioRxiv - Biophysics 2022Quote: ... and 10 units of T4-polynucleotide kinase (New England BioLabs, Ipswich, MA) in 70 mM Tris/HCl pH7.6 ...
-
bioRxiv - Cell Biology 2023Quote: ... Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs) in 1x PMP buffer supplemented with 100 μM unlabeled ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... nucleic acids extracted from SPARDA were phosphorylated by T4 polynucleotyide kinase (NEB) according to the manufacturer’s protocol and were separated by 18% PAGE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and end repaired with T4 Polynucleotide Kinase (T4 PNK; NEB, catalog # M0201) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation of RNA fragments was achieved using T4 Polynucleotide Kinase (NEB) and Adenosine 5’-Triphosphate (ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads were treated with 10 μl of T4 Polynucleotide kinase (PNK; NEB) in 100 μl of 1X T4 PNK Reaction buffer containing 1 U/μl SUPERase•In™ RNase Inhibitor at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...
-
bioRxiv - Biochemistry 2024Quote: ... The ATP and ADP makers were created using T4 polynucleotide kinase (NEB). T4 PNK mixed with 128 µM ATP supplemented with 10 nM [α-32 P]-ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was cut with Hind III and Bam HI (NEB) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and His-MBP-ZFC3H1 onto an Amylose resin (NEB). After extensive washing ...
-
bioRxiv - Immunology 2021Quote: ... were assembled using Hi-Fi DNA Assembly Mix (NEB). For the SFFV-Cas9 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Genomics 2021Quote: ... was then inserted by Hi-Fi assembly (NEB, E2621) using 0.025 pmols of vector and 0.05 pmols of the GFP amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEB Hi-Fi assembly mix (New England Biolabs). A mixture of the two guide plasmids (each at 100ng/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... We expressed the His-SUGCT in Lemo cells (NEB), inoculating 4L of TB with 4 mL overnight culture ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was phosphorylated for 1 h at 37oC with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Molecular Biology 2020Quote: Yeast total RNA was first treated with T4 Polynucleotide Kinase (PNK) (NEB M0201S) in order to remove possible phosphorylated 3’ends before polyA tailing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unprobed and probed RNAs were treated with T4 Polynucleotide Kinase (PNK) (NEB, M0201S) as described above before proceeding with ONT Direct cDNA sequencing.
-
bioRxiv - Genomics 2019Quote: ... the RNA was gel extracted and was dephosphorylated using polynucleotide kinase (NEB #M0201S). A Universal miRNA cloning linker (NEB # S1315S ...
-
bioRxiv - Microbiology 2019Quote: ... RNA fragments were dephosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA), precipitated ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Biophysics 2021Quote: ... pH 8.4 using cAMP-dependent protein kinase A (New England Biolabs, Frankfurt, Germany). The phosphorylated vimentin was mixed at the desired ratios of 1 ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Cancer Biology 2022Quote: Oligos of the gRNAs were annealed with T4 polynucleotide kinase (New England Biolabs) by PCR ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was removed 3’phosphoryl groups using T4 Polynucleotide Kinase (New England Biolabs) in the buffer (70 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Microbiology 2022Quote: RNAs for direct cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer’s non-radioactive phosphorylation protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligo pairs were annealed and phosphorylated by T4 Polynucleotide kinase enzyme (NEB, M0201S), chloroform extracted ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA primer end-labeling was accomplished using T4 polynucleotide kinase (T4 PNK, NEB) and 25 μCi of ATP ...
-
bioRxiv - Microbiology 2019Quote: ... Extracted crRNAs were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, MA, USA), radiolabeled with γ-[32P]-ATP (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... An aliquot of the purified amplicons was phosphorylated using T4 Polynucleotide Kinase (NEB) using the manufacturer’s recommended reaction mixture and we extended the incubation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each oligo pair was annealed using T4 Polynucleotide Kinase (PNK) enzyme (NEB, M0201S) and then cloned into the sgRNA(MS2)_puro backbone (Addgene 73795 ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated with 10 U of phosphatase-free T4 polynucleotide kinase (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM EDTA) and phosphorylated using T4 Polynucleotide Kinase (New England BioLabs M0201L) according to manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... The purified RNA was dephosphorylated with 1 µL of T4 polynucleotide kinase (NEB) in 1x T4 PNK buffer for 1 h at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... by incubating the DNA with T4 polynucleotide kinase (10 units; New England Biolabs) in the reaction medium provided by the supplier for 30 min at 37 °C ...