Labshake search
Citations for New England Biolabs :
201 - 250 of 2293 citations for Mouse ZNF583 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and parent plasmids were degraded by DpnI (NEB). All plasmids were transformed into DH5α cells.
-
bioRxiv - Cell Biology 2024Quote: ... plasmids were amplified using -inverse PCR (Q5, NEB), using primers with overhangs containing spacer sequences ...
-
bioRxiv - Microbiology 2024Quote: ... the plasmid was linearised with BsaI (NEB,UK). Linearize product was visualized by electrophoresis in 1% agarose gels and then purified from agarose gel ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmid was digested with AgeI (NEB #R3552) and EcoRI (NEB #R3101L ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plasmid was digested with BbsI (NEB R3539L) at 37°c overnight and purified with 1.0x AmPure Bead ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid backbone DNA was treated with DpnI (NEB) to remove PCR template DNA ...
-
bioRxiv - Systems Biology 2020Quote: ... Plasmids were constructed by gap repair either through in vivo recombination or the NEBuilder plasmid assembly tool (New England Biolabs, USA). Linear products were created by PCR with primers from Sigma Life Science and Q5 Polymerase (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmids from 120 CFUs with different phenotypes were isolated with the Monarch®Plasmid Miniprep Kit (New England Biolabs, Ipswich, USA) and analyzed via Sanger-sequencing (Eurofins Genomics ...
-
bioRxiv - Bioengineering 2019Quote: ... The linear PCR product was treated with DpnI enzyme to fragmente the template plasmid and self-ligated to generate circular plasmid (Quick Ligation™ Kit, NEB). Promoters containing multiple trpO sequences were constructed by USER cloning from a synthetic DNA fragment (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... EF1α Lamp1-mCherry plasmid was extracted from successful transformants with the Monarch® Plasmid Miniprep Kit (New England BioLabs Inc., USA), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... These fragments were introduced into the previously generated intermediate plasmid (after cutting the plasmid with SpeI [New England Biolabs®, Inc.]) by Gibson assembly to generate the division reporter pUC18-mini-Tn7T-Gm::tetR(BD)-Ptet-mCitrine_mCerulean3-BCD2-P14g.
-
bioRxiv - Biophysics 2021Quote: ... the T7 terminator site was removed from plasmid pIA146 by digesting the plasmid with HindIII and SphI (New England Biolabs, UK). Blunt ends were created using the Klenow fragment of DNA polymerase I (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Donor sequences which usually contain the upstream and downstream homologous arms of the gene being edited with 21-bp overlap of the XhoI-digested targeting plasmid at each end were amplified by PCR and ligated into the linearized targeting plasmid (digested by XhoI (NEB, USA)) using the ClonExpress II One Step Cloning Kit (Vazyme ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated at 37°C for 18 hours and the plasmid was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs, US) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids were constructed by gap repair either through in vivo recombination or the NEBuilder plasmid assembly tool (New England Biolabs, USA). Linear products were created through PCR with primers from Sigma Life Science and Q5 Polymerase (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... The R203M N175-245 plasmid was prepared from the WT N175-245 plasmid with site directed mutagenesis (NEB site mutagenesis kit). The plasmids were transformed into BL21(DE3 ...
-
bioRxiv - Biophysics 2023Quote: Plasmid pRS303 CBP-TEV-halo-orc3 gal1-10 orc4 was generated by cloning the CBP-TEV-halo sequence from plasmid pRS306-CBP-TEV-halo-Pri1-Gal1-10 Pri2 into plasmid pRS303-orc3-Gal1-10 orc4 through Gibson assembly (NEB #E2611L) using primers TL-446 ...
-
bioRxiv - Molecular Biology 2023Quote: ... were grown out in LB medium with 50 µg/mL Kanamycin and then pelleted before plasmids were isolated using the Monarch Plasmid Miniprep Kit (NEB, T1010L). Plasmids were sequenced (Sanger ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Positive colonies were incubated overnight at 37°C and plasmids were isolated using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). For all assembled plasmids the sequence was confirmed by Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... and the pHW2000 plasmid backbone such that the whole plasmid could be assembled in a one-pot golden gate reaction with PaqCI (NEB, #R0745S). Due to repeated regions ...
-
bioRxiv - Plant Biology 2021Quote: ... was amplified from pDONOR221-GNOMxCS plasmid and cloned into a pre-existing pGII(Bar)-pGNOM:GNOM-YFP plasmid using PspXI (New England Biolabs catalogue no R0656) and MscI (Thermo Scientific catalogue no ER1211 ...
-
bioRxiv - Genetics 2022Quote: ... Strains expressing exogenous Dbp1 from the LEU2 locus were created by cloning the DBP1 ORF as well as ∼1kb of upstream and downstream regulatory sequence into a single integration plasmid targeted to LEU2 This plasmid was linearized by digestion with SwaI nuclease (NEB, Ipswich, MA) and transformed into the dbp1Δ::KANMX6 strain.
-
bioRxiv - Genetics 2022Quote: ... The pBSMVγPDS plasmid and all plasmids expressing BSMV γ chain carrying sgRNAs were linearized with BssHII (New England BioLabs, catalog number R0199S). In vitro transcription was performed in 20 µL reaction volume using HiScribe™ T7 High Yield RNA Synthesis Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... was PCR amplified from pDONR221-SUMO2 plasmid (purchased from DNASU plasmid repository, United States) using Phusion® High-Fidelity DNA Polymerase (NEB, USA) with forward primer 5’ GATGGATCCATGGCCGACGAAAAG 3’ and reverse primer 5’ TTCAAGCTTTTAACCTCCCGTCTGCTG 3’ as per the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: 20ug of linearized plasmid with BamHI (New England Biolabs) of which 2ug was transcribed with MEGAscript T3 polymerase (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: ... the plasmid was digested with NarI and XbaI (NEB), subsequently the ends were blunted with Klenow (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... the plasmid was digested with NotI (New England Biolabs) at 37° C for 16 hours and transfected into the endogenously tagged Cep164C:mNG cell line as previously described ...
-
bioRxiv - Cell Biology 2020Quote: ... The final plasmid was linearized with NotI HF (NEB) prior to transfection ...
-
bioRxiv - Genomics 2020Quote: We digested the resulting plasmid with BseRI (NEB R0581L) and agarose gel-size selected the linearized fragment ...
-
bioRxiv - Genomics 2020Quote: ... we digested the plasmid library with BseRI (NEB R0581L) and agarose gel size-selected the linearized fragment ...
-
bioRxiv - Microbiology 2019Quote: Creation of plasmid was completed through Gibson Assembly (NEB) using a minimum of 20 bp overlapping regions of five DNA fragments following manufacturers protocol ...
-
bioRxiv - Genetics 2020Quote: ... 2μg purified plasmids were digested with KpnI/XbaI (NEB) and ligated with a KpnI/XbaI-digested fragment containing a promoter and reporter gene (EGFP) ...
-
bioRxiv - Genetics 2019Quote: ... plasmid was linearized with BbsI (R3539S, New England Biolabs) and gRNAs were ligated into the restriction site and verified through Sanger sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... plasmid length and gene endonuclease restriction with XbaI (NEB).
-
bioRxiv - Biochemistry 2020Quote: ... the plasmid (10 μg) was completely digested by NEB BsmBI or EarI restriction enzymes (Supp ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 20 units of DpnI (NEB; for removing template plasmid), and 5μl of 10x-CutSmart buffer (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: HDR template plasmids were generated using Gibson Assembly (NEB) cloning ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmids were transformed into NEB competent cells (NEB C2987I), purified with the NucleoBond Xtra Midi Endotoxin Free kit (Clon-tech 740420.50) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of plasmid was treated with Sssl (NEB) or mock as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were linearized using MluI-HF (New England BioLabs), RNA was generated using the MEGAscript T7 Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmids were generated using Gibson assembly (New England BioLabs) or In-Fusion cloning (Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... m and f plasmids using HpaI and AccI (NEB). The first linker ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid ligation was achieved with KLD Enzyme Mix (NEB) and completed plasmids were sequenced to verify correct mutations (Plasmidsaurus).
-
bioRxiv - Synthetic Biology 2022Quote: ... The plasmid was transformed into T7 express cells (NEB) according to manufacturer’s instructions and expressed in Luria-Bertani broth at 37 °C with shaking at 180 rpm before induction by IPTG at an optical density of 0.6 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and plasmid was PCR-linearized by Q5 polymerase (NEB) using primers (IDT ...
-
bioRxiv - Bioengineering 2022Quote: ... Plasmids and DNA were purified using Monarch kits (NEB) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... the pAdvAF300 plasmid was linearised with PacI (NEB, R0547S) and transfected into E1-complement HEK293A cells (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... coli for plasmid propagation were purchased from NEB (#C2987H).
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids were transformed into NEB5α competent cells (NEB C2987H) for Gibson Assembly or TOP10 competent cells (Thermo Fisher K204040 ...
-
bioRxiv - Microbiology 2022Quote: ... or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB) in reaction containing 1X T7 buffer (50mM Tris-HCl ...