Labshake search
Citations for New England Biolabs :
51 - 100 of 2293 citations for Mouse ZNF583 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... linearized plasmid DNA was generated by digestion of pUC19 plasmid with BamHI (New England Biolabs). For bacteria-DNA interactions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmids were extracted by using the Monarch® Plasmid Miniprep Kit (New England Biolabs). The tRNA insert from isolated plasmids was then amplified with primers bearing the standard Nextera Illumina Read 1 and Read 2 primer binding sites ...
-
bioRxiv - Cell Biology 2023Quote: PCR and plasmid generation – All PCR for plasmid generation was conducted using Phusion polymerase (NEB) using primers listed in Supplemental Table 1 ...
-
bioRxiv - Genomics 2024Quote: ... Plasmid DNA were extracted from bacterial cultures using Monarch Plasmid Miniprep Kit (New England Biolabs) and sequenced using the BigDye Terminator v.1.1 kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids from O/N cultures were extracted with the Monarch Plasmid Miniprep Kit (New England Biolabs) and sent for sequencing to LGC genomics.
-
bioRxiv - Microbiology 2021Quote: ... two constructs (Fig. 1A) were made using a modified pgRNA-bacteria plasmid (NEB, Addgene plasmid # 44251). This plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... the plasmid was isolated from the dense culture using the Monarch® Plasmid Miniprep Kit (NEB) and the DNA was eluted with nuclease-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... the resulting plasmid and the Attl1-mCMV-Kozak-ATRX plasmid were digested with BstEII-HF (NEB) and MluI-HF (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA molecules were purified using a commercially available purification kit (MonarchQR Plasmid Miniprep Kit, NEB). The purified plasmids were run on a 0.8% agarose gel supplemented with 2.5 µg/mL of chloroquine in 1xTBE buffer containing 2.5 µg/mL of chloroquine at 25 V for 15 hours ...
-
bioRxiv - Genomics 2020Quote: pTYB21 plasmid (New England Biolabs, NEB) was linearized with EcoRV (NEB ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmids were linearized with NotI (NEB), purified with the Monarch PCR and DNA Cleanup kit (NEB) ...
-
bioRxiv - Bioengineering 2020Quote: ... the purified plasmids (New England Biolabs: Monarch® Plasmid Miniprep Kit ...
-
bioRxiv - Genomics 2020Quote: pTYB21 plasmid (New England Biolabs, NEB) was linearized with EcoRV (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were linearised with SacII (NEB): slit2 ...
-
bioRxiv - Microbiology 2021Quote: ... using Monarch Plasmid Miniprep kit (NEB). Sequencing was through the company Genewiz.
-
bioRxiv - Biochemistry 2022Quote: Plasmid KAC833 linearized with HindIII (NEB) was used as the DNA substrate for most in vitro cleavage reactions unless otherwise stated ...
-
bioRxiv - Synthetic Biology 2021Quote: ... plasmids were digested with NotI (NEB) before transformation ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmids were isolated using Monarch (NEB) or PureYield (Promega ...
-
bioRxiv - Genomics 2021Quote: ... and a pUC19 plasmid (NEB #N3041) treated with M.SssI CpG Methyltransferase (NEB #M0226).
-
bioRxiv - Plant Biology 2023Quote: ... cloned in the miniT plasmid (NEB), and the assemble with the Golden gate system using the modules for GFP ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmids were transformed into DH5α (NEB). The transformed cells were grown in 300 mL of LB media at 37 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... or Monarch® Plasmid Miniprep (NEB). DNA fragments that were generated by the polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were transformed into NEB5a (NEB) or CA434 competent E ...
-
bioRxiv - Immunology 2020Quote: ... white colonies were picked and the plasmids were isolated using the Monarch® Plasmid Miniprep Kit (NEB). To verify that the picked colonies contain an insert of the correct size ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid DNA from individual colonies was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). All cDNA clones were verified by complete DNA sequencing of the ORF in both the 5’-3’ and 3’-5’ directions.
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids from antibiotic-resistant clones were purified using a Monarch plasmid miniprep kit (New England Biolabs, USA) and subjected to whole plasmid sequencing (SNPsaurus ...
-
bioRxiv - Genomics 2021Quote: The GCG1/SUT098 FPR plasmid was digested with AvrII and BglII (1 U per µg plasmid, NEB) restriction enzymes to excise the NatMX6 cassette ...
-
bioRxiv - Microbiology 2020Quote: ... The initial pHSG396:IS26 plasmid extract and pHSG396:IS26 plasmid selected in TZP and extracted from NEB® 5-alpha E ...
-
bioRxiv - Genomics 2020Quote: ... Plasmid libraries were harvested from liquid culture using the Monarch® Plasmid DNA Miniprep Kit (NEB #T1010). Miniprep kit reagents were scaled to accommodate one spin column for every 5mL of culture.
-
bioRxiv - Microbiology 2022Quote: ... Isolation of plasmid DNA was performed with a Monarch Plasmid Miniprep Kit/T1010 (New England Biolabs, UK). The concentration and purity of DNA preparations were determined using a Nanodrop 2000 instrument (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were then isolated using the Monarch® Plasmid Miniprep Kit (New England Biolabs, Ipswich, MA, USA) and used to transfect HEK293T cells (ECACC ...
-
bioRxiv - Plant Biology 2020Quote: The mCherry plasmid FC1011 plasmid was constructed by NEBuilder HiFi DNA assembly Master Mix (New England Biolabs, MA) using pKA1 (CDKB plasmid ...
-
bioRxiv - Biochemistry 2022Quote: To generate the pPD95.75-mNG and pPD95.75-mSc plasmids the pPD95.75 plasmid was digested with KpnI and BsmI restriction enzymes (NEB), and the linearized plasmid gel-extracted and assembled with PCR-amplified codon-optimized mNeongreen or mScarlet using In-fusion cloning (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Plasmid DNA was digested using NotI (NEB) and mRNA was generated using mMessage machine in vitro transcription kit (ThermoFisher) ...
-
bioRxiv - Bioengineering 2021Quote: ... The plasmid was linearized using Esp3I (NEB). The DNA sequence of all plasmids was verified through Sanger sequencing (Macrogen Europe B.V.) ...
-
bioRxiv - Microbiology 2020Quote: ... 0.3 μg of pUC19 plasmid DNA (NEB) was added in the sample ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid was digested with SpeI (NEB) and XmaI (NEB) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Enriched plasmids were digested with EcoRV (NEB) for 8 hrs at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid pACYC177 (New England Biolabs, Ipswich, MA) was used to clone three fragments and a T7 promoter sequence (TAATACGACTCACTATAGGG ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid pJV452 was constructed by Gibson (NEB) assembly of pEDJ400 linearized with oligos JV498+JV499 ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: ... template plasmids were digested using DpnI (NEB). The wildtype and mutated viral sequence were constructed using overlap PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmid DNA was digested using XbaI (NEB) to cut upstream of the T7 promoter ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid was digested using Bbsl (NEB, R0539) and purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were transformed into BL21 DE3 (NEB) and clones were picked for growth in 40 mL LB (Melford ...
-
bioRxiv - Microbiology 2022Quote: Plasmids were linearized by AflII digestion (NEB) and then transformed into PichiaPink™ Strain one (Invitrogen ...
-
bioRxiv - Systems Biology 2022Quote: ... the plasmids were digested with BsmBI (NEB) following manufacturer’s recommendations and the backbone DNA with sticky ends were then separated in 1% agarose gel and purified for later use ...
-
bioRxiv - Microbiology 2022Quote: Plasmids were linearized by AflII digestion (NEB) and then transformed into PichiaPink™ Strain one (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... after digesting the plasmid with BsmBI (NEB). The sgRNA was transcribed from the BamHI linearized pT7-gRNA vector using the MEGAshortscript T7 kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... The pUC19 plasmid (NEB, Catalog number: N3041A) was then linearized with KpnI and BamHI and the 1.6kb amplified region was inserted into the linearized pUC19 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were linearized using XhoI (NEB) and extracted by phenol/chloroform (1:1) ...