Labshake search
Citations for New England Biolabs :
501 - 550 of 10000+ citations for Mouse T cell receptor alpha chain C region TCRA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Ligations into the respective backbone were performed overnight at 16°C using T4 DNA Ligase Kit (NEB, #M0202L). Ligations were transformed into NEB Stable E ...
-
bioRxiv - Biochemistry 2024Quote: ... at 37°C for 30 min and purified by Monarch RNA Cleanup Kit (New England Biolabs, Massachusetts, USA). The concentration of crRNA was determined by Nanodrop 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Novel mutants of Ecm2 were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs; Ipswich, MA). All plasmids were confirmed by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Zip codes were then amplified by polymerase chain reaction (PCR) from 200 ng of DNA template using Phusion ® High-Fidelity (HF) DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... neon-Green and mScarlet, these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The genes of interest were amplified by polymerase chain reaction (PCR) using Q5 high fidelity DNA polymerase (New England BioLabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was amplified via polymerase chain reaction (PCR) using the proof reading Phusion® high fidelity (HF) polymerase (Phusion) (New England Biolabs). Reactions were heated to 98 0C for 30 s ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Synthetic Biology 2021Quote: minD,minE and FtsA genes were amplified by standard polymerase chain reaction (PCR) amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs, USA) as previously reported24,30 ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: sgDNA template was generated using gene-specific oligonucleotides and constant oligonucleotide by polymerase chain reaction for 30 cycles using Q5 high fidelity polymerase (NEB, USA). PCR product was further purified using Magbio Hiprep PCR cleanup system (Magbiogenomics ...
-
bioRxiv - Biochemistry 2022Quote: The P562del and Exo+THR mutants were generated on the pET23-P2-D12A-THR (Table S1) background through inverse Polymerase Chain Reactions (iPCR) using Q5® High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions in 25 μl reactions with primers p2_thumb_loop_R/DEL1 (Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or 279bp (high cost) of regulatory region (Fig. S1) and cloned into pKD3 upstream of the chloramphenicol resistance cassette using Gibson Assembly (NEB). Primers to amplify hilD contained ∼40bp homology to the sites flanking a NdeI site in pKD3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The chloramphenicol resistance cassette amplicon was ligated to the pilA1 upstream and downstream flanking region amplicons using restriction enzyme cloning with SacI and XbaI (New England Biolabs) and T4 DNA ligase (Invitrogen) ...
-
bioRxiv - Developmental Biology 2019Quote: ... A short stretch of genomic region (∼600-800 bp) flanking the target site was amplified using Q5 Hot Start High Fidelity 2 × Master Mix (NEB). Amplified sequences were purified with the QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... with p426-crRNA-CAN1.Y that had been cut with NheI and Acc65I to replace the CAN1.Y guide target region with a stuffer fragment that could be released by BaeI (NEB) and allow any guide to be inserted easily (p426-crRNA-BaeI) ...
-
bioRxiv - Bioengineering 2021Quote: ... were synthesized (Genewiz) based on the GenBank sequences with regions of overlap to restriction digested human IgG1 vectors for assembly cloning (NEB) to produce plasmids ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The double-stranded template was produced by annealing the strands and filling in the single-stranded regions with Phusion HF PCR Master Mix (NEB) by cycling between the melting temperature of the strands and 72°C twenty times ...
-
bioRxiv - Plant Biology 2020Quote: ... a 6.5-kbp promoter region was incorporated into pDONRP4-P1R by assembling four PCR fragments with the Gibson Assembly technology (New England BioLabs). The protocol for the Gibson assembly ...
-
bioRxiv - Plant Biology 2021Quote: ... the 560 bp region upstream of the transcription start site was amplified using Q5 high fidelity DNA polymerase (NEB, England) and ligated into EcoRV digested SK+ cloning vector ...
-
bioRxiv - Microbiology 2021Quote: ... coding regions and flanked by the BSSHII and ApaI restriction sites— of pNL43 cloned into the pMiniT 2.0 vector (NEB, USA). This pMiniT2-Gag/BssHII-ApaI intermediary plasmid was constructed by cloning a PCR amplicon obtained by using custom-made forward primer harboring BssHII site (5’- TATAGCGCGCACGGCAAGAG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Heavy and light chain sequences were amplified with primers specific for the TSO handle-sequence and the respective constant region sequence with Q5 Polymerase (New England Biolabs). Following Sanger sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... a kanamycin cassette bookended with FRT sites from plasmid pKD4 with 60-bp homology to the upstream and downstream region of mgrB was PCR amplified using high fidelity Q5 polymerase (New England BioLabs [NEB]). The purified PCR product was then electroporated into the target strain (AZ63 ...
-
bioRxiv - Immunology 2022Quote: ... 700-bp sequences of the flanking regions of the selected gene were amplified by PCR with Q5 high fidelity polymerase (New England Biolabs). Then ...
-
bioRxiv - Plant Biology 2021Quote: ... Flanking sequences 5’ and 3’ of the coding regions were amplified with appropriate primer pairs (Table S2) using Phusion DNA polymerase (New England Biolabs) and cloned into pDONR 221 P1-P4 and pDONR 221 P3-P2 ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting gDNA was used as template for PCR amplification of the shRNA encoding regions using the Fw-NGS and the Rev-NGS primers (IDT Technologies) and the Phusion High Fidelity DNA polymerase (NEB). Three PCRs per condition were performed and the amplicons combined ...
-
bioRxiv - Biochemistry 2021Quote: ... were synthesized (Genewiz) based on the GenBank sequences with regions of overlap to restriction digested human IgG1 vectors for assembly cloning (NEB) to produce plasmids ...
-
bioRxiv - Bioengineering 2019Quote: ... the target region was PCR-amplified using primers Deep-F1/R1 with 25 cycles using Q5 High-Fidelity 2X Master Mix (NEB). Second ...
-
bioRxiv - Immunology 2019Quote: ... 700-bp sequences of the flanking regions of the selected gene were amplified by PCR with Q5 high fidelity polymerase (New England Biolabs). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... We used 5 ng of each plasmid elute as PCR template and amplified out the portion of interest using 0.5 μM of primers annealing to the region of the sgrS sequence under consideration with Phusion 2X Mastermix (NEB, M0531L). We employed 20 cycles of 10 s at 98 °C denaturation ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplification was performed with primers targeting the indicated regions (Fig. 1B, Supplemental Table S1) using Taq DNA Polymerase (New England Biolabs) for 30 cycles of amplifying protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Primers flanking the transgene were then used to amplify the entirety of the RBD::mClover coding region using Q5 DNA polymerase (New England Biolabs). PCR amplicons were size-verified by electrophoresis on a 0.8% TAE agarose gel stained with SYBR Safe (Thermo Scientific ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... The target regions were amplified by PCR with either Taq-HP DNA Polymerase (Biospecifika Novosibirsk, Russia) or LongAmp Taq DNA Polymerase (NEB) (primers sequences could be found in electronic supplementary material Table S3) ...
-
bioRxiv - Cancer Biology 2019Quote: ... desired protospacer and a truncated constant region of the tracrRNA were annealed and amplified with Phusion high-fidelity DNA polymerase (New England Biolabs) to produce the chimeric sgRNA template for transcription ...
-
bioRxiv - Immunology 2021Quote: ... and used as template to test for binding of the PMCA4b promoter region using Q5 hot start polymerase (NEB biolabs) and the primers ...
-
bioRxiv - Developmental Biology 2021Quote: A ~5kb genomic sequence containing 2kb promoter and entire genomic region of tes-1 was PCR amplified using Phusion polymerase (NEB). The primers used were ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... The thyA gene region was amplified from the genomic DNA (5 ng) with Phusion High-Fidelity PCR Master Mix (New England Biolabs) using 200 nM of thyA forward and reverse primers that give amplicons of 750 bp ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with primers 515F–806R targeting the V4 region of the 16S rRNA using Phusion High-Fidelity DNA Polymerase (NEB). The PCR product concentration was measured with Quant-iT PicoGreen dsDNA Assay Kits (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: PCR-generated fragments of the CNX1 and CNX2 genomic regions lacking stop codons and including the 1-kbp promoter regions were obtained using Phusion HF DNA polymerase (New England Biolabs), inserted into pENTR-2B ...
-
bioRxiv - Immunology 2022Quote: BsAbs were generated by introducing amino acid mutations (F405L or K409R) in the HC constant region of the parental mAbs by Q5 Site-Directed Mutagenesis (New England Biolabs). Individual mutated mAbs were produced in HEK293F cells and purified as reported above ...
-
bioRxiv - Microbiology 2023Quote: ... A region containing the putative promoter region of the fhuD1/spm operon was amplified by Phusion High-Fidelity DNA polymerase (New England BioLabs) with the primers listed in Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... The tcaA promoter region was also digested with EcoRI and SmaI and ligated into pSB2019 using T4 DNA ligase (NEB). This was transformed into DC10B37 ...
-
bioRxiv - Microbiology 2023Quote: ... was generated by amplifying 1 kb fragments upstream and downstream of the region (Table 4) and cloned into pKNOCK-bla-erm57 using NEBuilder (NEB). The plasmid was conjugally transferred into B ...