Labshake search
Citations for New England Biolabs :
451 - 500 of 10000+ citations for Mouse T cell receptor alpha chain C region TCRA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction was performed using a 50 µL master mix consisting of 1x standard Taq buffer (New England Biolabs), LCO1490 primer (0.2 mM) ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into human IgG expression vectors ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized first-strand complimentary DNA was used to amplify the heavy-chain variable domains using Q5 high-fidelity DNA polymerase (New England Biolabs) and the described primers (CALL001 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the templates were prepared by polymerase chain reaction (PCR) amplification from corresponding plasmid constructs using Q5 DNA Polymerase Master Mix (NEB). The PCR reaction was worked up using a Qiagen PCR purification kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genes were amplified in polymerase chain reactions (PCRs) using oligonucleotides with XhoI and KpnI restriction site overhangs and digested with the respective enzymes (NEB). pcDNA3.1 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into IgG expression vectors ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Biophysics 2019Quote: ... All the p53[R273] point mutations are done using overlap extension polymerase chain reaction by primers which are shown in Table S2 and then digested with Nde1(NEB) & BamH1(NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Tetravalent antibody constructs were generated by fusing these fragments with their respective IgG heavy chain in the pSCSTa mammalian expression vector using Gibson assembly (NEB). Fab-IgG constructs were arranged by fusing a heavy chain Fab domain to the N-terminus of the IgG via a S(G4S)3 linker ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Bioengineering 2022Quote: All gene amplifications were performed using polymerase chain reaction (PCR) in a 50 µL mix with Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to the manufactureŕs protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2022Quote: ... We amplified the wild-type EST1 gene from the genome of the haploid strain BY4742 by polymerase chain reaction (PCR) using the high-fidelity Q5 polymerase (NEB) and inserted it into the ΔEST1 cells used in [1] by CRISPR/Cas9 editing ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain variable domain was then amplified from the cDNA using Q5 high-fidelity DNA polymerase (New England Biolabs) with the described primers (CALL001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... The remainder of the adapter sequences were added to the heavy and light chains separately by a two-step PCR reaction with Q5 using the NEBNext index primers (NEB) 98°C for 30s ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... homology arms flanking the region to be deleted were obtained using polymerase chain reaction (PCR) and cloned into the pExG2-KanR suicide vector using Hi-Fi Assembly (New England Biolabs)70 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Microbiology 2023Quote: ... mRNA molecules are captured using magnetic Oligo d(T)beads (NEB). Following purification ...
-
bioRxiv - Bioengineering 2023Quote: PstI-HF restriction enzyme (NEB cat. no. R3140S/L/T/M)
-
bioRxiv - Bioengineering 2023Quote: BamHI-HF restriction enzyme (NEB cat. no. R3136S/L/T/M)
-
bioRxiv - Genetics 2024Quote: ... One microliter of oligo d(T)23VN primer (50 μM) (NEB) was added to 200 ng/µL of RNA (170 ng worm RNA + 35 ng yeast RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Systems Biology 2019Quote: ... 30°C and the growth was continuously monitored online using Cell Growth Quantifier (Aquila Biolabs GmBH). Samples were withdrawn at regular intervals for analyzing the spent metabolites through High-Performance Liquid Chromatography (HPLC).
-
bioRxiv - Genomics 2022Quote: ... cells were digested for 2 hours at 37°C using 375U of MboI (NEB, Cat. #R0147). After biotin filling ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... The E PBM C-terminal mutation (DVLL>GGGG) was performed using the Q5 site-directed mutagenesis kit (NEB). The sequences corresponding to the PDZ domains were cloned into the pCMV GFP vector using EcoRI and XhoI sites.
-
bioRxiv - Biochemistry 2021Quote: ... also C-terminal) FT MYOC variants were generated by DNA assembly (NEBuilder HiFi DNA Assembly Cloning Kit, NEB) by combining a PCR-amplified eGLuc2 product from a pcDNA3 MYOC eGLuc2 plasmid (originally described previously8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Micro-C libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) following77 manufacturer instructions and sequenced on the Illumina NovaSeq 6000 platform.