Labshake search
Citations for New England Biolabs :
551 - 600 of 10000+ citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Biochemistry 2021Quote: ... and one plasmid was randomly selected from those plasmids and used for expression with a PURE system (PURExpress In Vitro Protein Synthesis Kit, New England BioLabs, Ipswich, MA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 1.0 mg/mL protein using homogenization buffer and incubated with 20 U/μL lambda phosphatase in MnCl2 and enzyme buffer as supplied with the lambda protein phosphatase kit (New England Biolabs, Evry-Courcouronnes, France) for 3 h at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added 150 – 1000 ng of DNA to 1 μl of prepared MBD2-Fc/protein A beads (New England Biolabs), then washed and eluted the DNA as described by Chiou and Bergey (2018) ...
-
bioRxiv - Genomics 2021Quote: ... equal amount of naked DNA and DNA bound by Reb1 protein (~ 5pmol) were incubated with AAG (10 units) and APE1 (1 unit) (New England Biolabs) in a 20 μL reaction containing 1X Thermopol buffer (20mM Tris HCl pH 8.8 ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction was stopped with a final concentration of 50 mM EDTA and the proteins were removed by treatment with proteinase K (1/100 of the volume – NEB) and SDS (0.1% ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... Products spanning the open reading frame of each gene were amplified with a high-fidelity Phusion® (NEB) DNA polymerase ...
-
bioRxiv - Plant Biology 2020Quote: ... The silencing triggers for all other nucleotide biosynthesis genes were amplified with Phusion DNA polymerase (New England Biolabs) using the oligonucleotides listed in Supplemental Data Set 8 ...
-
bioRxiv - Microbiology 2020Quote: ... Genes were amplified from the relevant gDNA using the primers given above and Phusion polymerase (New England Biolabs), following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... by digesting both pCTCON2-RXG and the PCR-amplified BFP gene with EcoRI-HF and BamHI-HF (NEB), then ligating with T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... upstream and downstream regions of about 750 bp flanking the bspL gene were amplified by PCR (Q5 NEB) from B ...
-
bioRxiv - Bioengineering 2021Quote: ... H2-Db and H2-Kb genes were engineered with a C-terminal cysteine by site-directed mutagenesis (NEB), and pMHC molecules were expressed and refolded as described previously[40] ...
-
bioRxiv - Microbiology 2020Quote: ... Cloned genes (below) were used as template DNA for PCRs with Phusion polymerase (New England Biolabs, Ipswich, MA). Complete dsRNA synthesis protocols ...
-
bioRxiv - Microbiology 2022Quote: ... resulting in a linearized vector into which synthetic variant spike genes can be assembled using Gibson Assembly (NEB). The Gibson Assembly reaction was then transformed into TransforMax™ EPI300™ Electrocompetent E ...
-
bioRxiv - Microbiology 2022Quote: ~500 bp sequences flanking the fadX gene (SAUSA300_0229) were amplified by PCR using Q5 DNA Polymerase (NEB M0491L). For cloning purposes ...
-
bioRxiv - Microbiology 2022Quote: ... PCR of a spike gene fragment was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Bioengineering 2021Quote: ... H2-Db and H2-Kb genes were engineered with a C-terminal cysteine by site-directed mutagenesis (NEB), and pMHC molecules were expressed and refolded as described previously (19).
-
bioRxiv - Microbiology 2019Quote: ... primase P4 and a hypothetical gene of joined anacy_RS29550 and anacy_RS29775 were PCR amplified by Phusion High-Fidelity DNA Polymerase (NEB) with specific primers listed in Table S1 ...
-
bioRxiv - Molecular Biology 2020Quote: SP graftings were performed using overhanging primers to the various V-genes via PCR using Q5 polymerase (NEB) with the following primers ...
-
bioRxiv - Immunology 2019Quote: ... the gene fragment and the linearized vector were linked by T4 DNA ligase (New England Biolabs, MA, USA). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: ... The repair templates were ordered as gene blocks (IDT) and PCR amplified with Phusion polymerase (NEB cat.#M0503S). The RPS25 KO1 cells were seeded into the well of a 6-well plate at 250,000 cells/well and 24 hrs post-seeding the PX458 plasmids and respective homology templates were co-transfected into the RPS25 KO cells using Lipofectamine 3000 (ThermoFisher cat.#L3000075) ...
-
bioRxiv - Genetics 2020Quote: ... Gene amplification was performed using the Phusion High Fidelity PCR Master Mix with HF Buffer (New England Biolabs) and primers KhE5-4 (GACGGTGACACTGTTCATGC ...
-
bioRxiv - Microbiology 2021Quote: ... a kanamycin resistance gene flanked by FRT sites was amplified from pFKM1 using Q5 high-fidelity polymerase (NEB) and primers with 75 bp oligonucleotide tails homologous to the sequences up and downstream of the arn operon (KM9H9-F ...
-
bioRxiv - Immunology 2020Quote: The second PCR product (V, D, J heavy genes) was cloned in frame by HiFi assembly (NEB, UK) into the KpnI/PstI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... upstream and downstream regions of about 750 bp flanking the each gene were amplified by PCR (Q5 NEB) from the B ...
-
bioRxiv - Immunology 2022Quote: ... The targeted gene region was amplified by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... quantification of relative mRNA levels of target genes was performed using the LunaR Universal qPCR Master Mix (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed on genes within pDNR207 constructs with Q5 High-Fidelity polymerase (New England Biolabs, Ipswich MA), and all constructs were sequence verified by GeneWiz prior to cloning into binary vectors ...
-
bioRxiv - Microbiology 2023Quote: ... The 720 bp lpxE gene was amplified by PCR from pUC57::lpxE using Q5 polymerase (New England Biolabs) and primer set lpxE-F/lpxE-R ...
-
bioRxiv - Immunology 2023Quote: ... were first formed by mixing 1μg sgRNA/gene with 1μg Cas9 (Cas9 NLS, S. pyogenes, New England Biolabs) at room temperature for 25-30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... of the human PNKP (gene accession#NM_007254.4) was amplified using the Q5 hot start high fidelity DNA polymerase (New England Biolabs), with HEK293 genomic DNA as a template ...
-
bioRxiv - Developmental Biology 2023Quote: ... At least 3 sgRNAs per gene were cloned using ssDNAs oligoes (IDT) and NEBuilder HiFi DNA Assembly (NEB) into modified backbone ...
-
bioRxiv - Biophysics 2023Quote: ... p-SFG retroviral backbone containing an IRES-ΔCD19 reporter gene was linearized by NotI-HF (NEB, ref: R3189S) and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Constructs for plasmid-based expression of genes were generated using PCR and Gibson Assembly® (NEB, Boston, MA) followed by cloning into pMQ72 ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA containing one copy of the SIV gene was linearized using EcoR1 (New England Biolabs, Ipswich, MA) following their restriction digest protocol (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... The gene of interest was amplified using primers described using either Q5 High-Fidelity DNA polymerase (NEB; M0491S) or Platinum Taq DNA polymerase High Fidelity (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Microbiology 2023Quote: ... The glycoprotein gene fragments and pCAGGS/MCS DNAs were ligated with Instant Sticky-End Ligase (New England Biolabs) and transformed into competent E ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis of TBK1 and Rab7 genes was performed using Q5 High-Fidelity 2X Master Mix (NEB). Plasmids are listed in Table 3 and were confirmed by Sanger Sequencing (Keck DNA Sequencing facility ...
-
bioRxiv - Immunology 2024Quote: ... we amplified the targeted gene regions by PCR (NEB Next High-Fidelity 2xPCR Master Mix; New England Biolabs) using primers (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... and combined with corresponding gene inserts in Gibson reactions (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs) to allow integration of targeted genes ...
-
bioRxiv - Plant Biology 2024Quote: ... but with a blasticidin S-deaminase gene in lieu of SHBLE (Buck, Río Bártulos et al. 2018) introduced by NEB Hi-Fi kit as before ...
-
bioRxiv - Cell Biology 2020Quote: ... 1200 units λ-protein phosphatase (NEB) were diluted into phosphatase assay buffer without cell lysate ...