Labshake search
Citations for New England Biolabs :
201 - 250 of 359 citations for Modified Jis Pcb Alt B Calibration Solution Cs0.4H Unlabeled 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... mini Ph or full length Ph variants were first cloned into a house-modified Gateway donor vector using Gibson cloning (HiFi Assembly, NEB) or restriction-ligation cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... modified with an EF1a promoter and a Basticidin resistance gene using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Specific primers and NEBuilder HiFi DNA Assembly Master Mix were used to introduce the exon E6a or the R238W mutation into the canonical sequence of NT5C2.
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The solution was then treated with 40 units of exonuclease I (NEB) and 40 units of exonuclease III (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... 26ul 20x SSC solution (InvitrogenTM 15557044) and 15ul RNase inhibitor (NEB M0314L). The 2ml tube was put in 50 °C water bath overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... These targets were precipitated out of solution with streptavidin magnetic beads (NEB) and the DNA was isolated out of the complexes with Proteinase K (Amresco ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 μL of 10 mM Deoxynucleotide (dNTP) solution mix (New England Biolabs) was added to each reaction and nuclease -free water was used to make up the remaining reaction volume ...
-
bioRxiv - Biophysics 2022Quote: ... The mixture was assembled with the following: 3.2 µL solution A (NEB), 1 µL factor mix (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Biochemistry 2022Quote: ... The working solution at 1.53 μM was obtained using Diluent A (NEB) and 1% Triton X-100 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resulting aqueous solution was concentrated using a spin column (Monarch, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... TET2 reaction was terminated by addition of 0.6 μL stop solution (NEB) and incubation at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2019Quote: All TXP2 constructs were cloned as N-terminally tagged Strep6xHisGFP-TEV-TPX2 fusions using a modified pST50 vector (Tan et al., 2005) and cloned via Gibson assembly (NEB: E2611L). An identical strategy was used to generate StrHisTEV-mCherry-FL_TPX2 ...
-
bioRxiv - Cell Biology 2019Quote: A derivative vector from modified TMPrtTA (3, 70) was created with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). Backbone was digested with EcoRV-HF (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was linearized by PCR with oligos designed to flank the metY gene (Table S5) and the modified metY(AAC) gene was then inserted using homologous recombination (NEBuilder HiFi DNA Assembly kit (NEB#E2621)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each desired sgRNA vector was modified from our previously published pll3-U6-sgRNA-Pgk-Cre vector via site-directed mutagenesis (New England Biolabs, E0554S). The generation of the barcode fragment containing the 8-nucleotide sgID sequence and 20-nucleotide degenerate barcode ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... These target genes were constructed into a modified PiggyBac (PB) transposon vector EIRBsMie using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, E2621L) described previously (44).
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... RNA is subsequently ligated with an “RNA Phosphate Modified” (RPM) adaptor (Quinodoz et al 2021) using High ConcentrationT4 RNA Ligase I (NEB, M0437M). Beads were incubated at 24°C for 1 hour 15 minutes with shaking at 1400 rpm ...
-
bioRxiv - Genetics 2023Quote: ... Libraries for sequencing were prepared with a modified version of the Next Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645S). Sequencing was performed on an Illumina HiSeq 3000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Genetics 2024Quote: ... The B splice form (Spc105RB) was generated using site directed mutagenesis to delete the first intron from the A form (NEB BaseChanger Kit). All mutants were generated using site specific mutagenesis of the A- or B-form Spc105R coding region in the pENTR4 vector ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 95 µL PNK solution (1× T4 DNA ligase buffer (NEB), 0.1% Triton X-100) ...
-
bioRxiv - Molecular Biology 2019Quote: ... XPG solution was mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in dialysis buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... the plasmid solutions were incubated for Nb.Bsmi nicking enzyme (R0706S, New England Biolabs) for 60 minutes at 65°C in NEBuffer 3.1 ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Biophysics 2021Quote: ... 200μl of a 50ng/μl solution (using Lambda DNA, New England Biolabs (NEB) N3011S) ...
-
bioRxiv - Biochemistry 2020Quote: ... Reactions were quenched on ice and by addition of 1x Stop Solution (NEB). Immediate isopropanol-based precipitation recovered 75- 95% of input mRNA as mRNA fragments in water.
-
bioRxiv - Neuroscience 2022Quote: RNA solution was then treated with DNase I (RNase-free) (New England Biolabs) to remove genomic DNA from sample and protected against RNA degradation using RNasin® Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Genomics 2022Quote: ... a 750 μl solution containing 1x NEB T4 DNA ligase buffer (NEB B0202), 120 μg BSA (ThermoFisher AM2616) ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 μl of deoxynucleotide (dNTP) solution mix (40 μM; New England Biolabs, UK), 1 μl of forward primer (10 μM ...
-
bioRxiv - Biophysics 2023Quote: ... The solution was supplemented with 0.1 vol of 10X T4 ligase buffer (NEB) and T4 ligase (30 U.μL-1 ...
-
bioRxiv - Genomics 2020Quote: ... These were ligated to modified Illumina P1 and P2 adapters overnight at 16 °C with 1,000 units of T4 ligase (New England Biolabs, Beverly, MA, USA), followed by a 10-minute heat-deactivation step at 65 °C ...
-
bioRxiv - Biophysics 2022Quote: PME measurements were carried out using a transient expression vector we created by inserting a synthetic gene block encoding the cDNA sequence of the human β2AR (Integrated DNA Technologies, Coralville, IA) into a modified pcDNA5 FRT using the NEBuilder kit (New England Biolabs, Ipswitch, MA). The final construct was designed to generate β2AR bearing an N-terminal influenza hemagglutinin tag from a transcript that also features a downstream internal ribosome entry site (IRES)-dasher GFP cassette that facilitates the unambiguous identification of positively-transfected cells ...
-
bioRxiv - Genetics 2020Quote: ... V416I and S438N were modified by site-directed mutagenesis PCR using Phusion®High-Fidelity DNA Polymerase (New England Biolabs, Massachusetts, USA). pGEMHE constructs were linearized using sbfI (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... The modification of mmACP and mtDod-mmACP (both variants with H8-Tag and without) with CoA 488 (CoA modified with ATTO-TEC dye ATTO 488, NEB #S9348) by Sfp was conducted in phosphate borate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... the NPTII gene cassette (including promoter and terminator) was cloned into pAGM1311 and modified using HiFi DNA Assembly Cloning Kit (NEB, Ipswitch, MA) to replace the complete coding sequence of NPTII with the coding sequence of the hygromycin resistance gene from pMDC735 ...
-
bioRxiv - Molecular Biology 2023Quote: ... This sequence was inserted into a modified pST50 vector56 containing N-terminal Strep-6xHis-TEV-GFP-PreScission tags using Gibson assembly (NEB Cat #: E2611L) to obtain a tagged construct of full-length HURP ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the C-terminus of clpP1 were amplified by PCR using the A–B and C–D primer pairs from Table 2 (Phusion polymerase, GC buffer, New England Biolabs, Ipswich, United States). For clpP2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The complexation reaction was carried out in a solution containing 1X NEBuffer 2.1 (NEB) (composed of 100 mM NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... This was repeated with a 1:200 pA-Dam solution (∼60 NEB Dam units), followed by 2 wash steps ...
-
bioRxiv - Biophysics 2019Quote: ... and stained with staining solution (1 µM BG-AF647 [Cat#S9136S, New England Biolabs, Ipswich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... These reaction solutions included the same reagents as the commercial reaction buffer from NEB but without Tris-HCl ...