Labshake search
Citations for New England Biolabs :
1 - 50 of 359 citations for Modified Jis Pcb Alt B Calibration Solution Cs0.4H Unlabeled 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... 7.5 μL solution B (NEB #E6800), 2 μL E ...
-
bioRxiv - Microbiology 2023Quote: ... or additional unlabeled ATP (NEB) were added to each reaction as indicated ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Biochemistry 2019Quote: ... unlabeled AdoMet was left out and 6 μg of MBP2* protein (NEB) was added to each reaction to increase molecular crowding.
-
bioRxiv - Molecular Biology 2023Quote: Unlabeled purified RNA targets were dephosphorylated using 1 U antarctic phosphatase (NEB) incubated with 1X of provided buffer during 20 min at 37°C and then 5 min at 65°C to inactivate the enzyme ...
-
bioRxiv - Biophysics 2023Quote: ... the digoxigenin-labeled and unlabeled amplicons were ligated with T7 ligase (New England BioLabs) in a specific ratio of 1:2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Genomics 2022Quote: ... the 1:99 target:background sample was digested with FspEI (New England Biolabs) according to the manufacturers protocol (incubation at 37°C for 90 minute ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Developmental Biology 2021Quote: DNA probes were generated by annealing 5’ IRDye®700 labeled forward oligonucleotides with unlabeled reverse oligonucleotides (Integrated DNA Technologies) to a final concentration of 5 μM in PNK buffer (New England Biolabs). One hundred femtomoles of labeled IRDye®700 probes were used in a 20-μl binding reaction containing 10 mM Tris ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Biophysics 2021Quote: ... coli B ER2566 from NEB; ampicillin ...
-
bioRxiv - Bioengineering 2019Quote: ... Unlabeled tracrRNAs were synthesized by IDT or through in vitro transcription (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, NEB) using DNA templates containing a T7 promoter binding sequence and full length tracrRNAs ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmid length DNA binding experiments were performed with unlabeled circular or linearized M13mp18 single (New England Biolabs, M13mp18 single-stranded DNA) or double-stranded DNA (New England Biolabs ...
-
bioRxiv - Bioengineering 2021Quote: ... All experiments for the calibration curve with Influenza and SARS-CoV-2 were performed with the Colorimetric LAMP mix from NEB. Real-time colorimetric LAMP (qcLAMP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein concentration in the growth medium was quantified by measuring fluorescence at 610 nm following excitation at 575 nm in comparison of signals with a calibration curve prepared from mCherry which was cloned into pQE30 (NEB), expressed in E ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... Histone yields from each purification were determined by using a calibration curve of recombinant H3 and H4 (NEB, cat. #M2503S, #M2504S, respectively). Absolute amounts of histone were determined by densitometry on coomassie-stained bands with Fiji61 for Pristionchus data (conducted at the MPI in Tübingen ...
-
bioRxiv - Biochemistry 2021Quote: ... bovine RNase B and fetuin (New England Biolabs) by PNGase F (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Molecular Biology 2023Quote: ... fixed nuclei resuspended in 171 uL SPBSTM were mixed with 99 uL NTP buffer and 30 uL T7 polymerase mix (New England Biolabs) and incubated in a 1.5 mL LoBind tube (Eppendorf ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a modified pGGA vector (New England Biolabs, USA) containing a red fluorescent protein and carrying chloramphenicol resistance gene was used for facilitating the screening of positive bacterial transformants [32] ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Cell Biology 2021Quote: ... m6A-modified RNA spike-in controls (New England Biolabs) and a nontargeted region on the crRNA-targeted transcript ...
-
bioRxiv - Cell Biology 2021Quote: ... with a destination vector modified from pMAL-c2 (NEB) by insertion of the Gateway cassette (ThermoFisher ...
-
bioRxiv - Zoology 2022Quote: ... Synthesized RNA was modified by Vaccinia Capping System (NEB), mRNA cap 2’-O-methyltransferase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... The modified RNA was subsequently column-purified (NEB # T2030), 2 pmol were digested to single nucleosides using the Nucleoside Digestion Mix (NEB # M0649) ...
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Microbiology 2019Quote: ... and then modified using T4 Polynucleotide Kinase (New England Biolabs), which removes the 3’-phosphate and adds 5’-phosphates ...
-
bioRxiv - Cell Biology 2021Quote: ... The m6A-modified and unmodified control RNAs (New England Biolabs) were divided into fragmented RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was modified using the Q5 Site-Directed Mutagenesis Kit (NEB) so that the gRNA sequence was replaced with two restriction enzyme sites (sequence ...
-
bioRxiv - Synthetic Biology 2020Quote: ... facilitated by expression in a modified pMal-p4x vector (NEB), pSHT18 ...
-
bioRxiv - Cancer Biology 2023Quote: ... constructs were modified using Q5® site-directed mutagenesis (NEB) to remove either the 4-1BB costimulatory domain (TNFRSF8-CD3ζ ...
-
bioRxiv - Biochemistry 2022Quote: ... RNase B from bovine pancreas (New England Biolabs, Ipswich MA, USA), and horse radish peroxidase (HRP ...
-
bioRxiv - Microbiology 2024Quote: ... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... pGP was modified from a commercially available plasmid pCMV-Gluc (NEB), in which contains a set of cellular 5’-noncoding sequences (41 nts ...
-
bioRxiv - Microbiology 2021Quote: ... This plasmid was further modified using Q5 Site Directed Mutagenesis (NEB) to add the custom adaptors ACACTCTTTCCCTACACGACGCTCTTCCGATCT and GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5μg of the modified BACs was linearized with PI-SceI (NEB) and electroporated into 3×106 mESCs ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution (NEB) DNase digestions were performed ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 3.2 μL solution A (NEB), 1 μL factor mix (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... The reaction solution was prepared in the following order: 10 μL solution A (NEB #E6800), 7.5 μL solution B (NEB #E6800) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid constructs were modified by site-directed mutagenesis (E0554; New England Biolabs) to create the desired mutations in klp-6 and cwp-4 ...
-
bioRxiv - Biochemistry 2020Quote: ... into a modified pMAL2c parent vector (New England Biolabs, Ipswich, MA, USA). The modified vector had a TEV MBP cleavable fusion and a modified MCS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...