Labshake search
Citations for New England Biolabs :
151 - 200 of 8949 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 0.1 µg/µl bovine serum albumin (New England Biolabs, Pickering, ON, Canada), and 30 ng of DNA ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 μl bovine serum albumin (BSA) (New England Biolabs, Ipswich, MA USA) and 2.5 μl dimethyl sulfoxide (DMSO ...
-
bioRxiv - Systems Biology 2022Quote: CAM-modified tryptic digest of bovine serum albumin (New England BioLabs Inc.) was labeled with dimethyl using the in-solution labeling protocol (Boersema et al ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 µg/µl bovine serum albumin (New England Biolabs, Pickering, ON, Canada), 30 ng of DNA template ...
-
bioRxiv - Genomics 2023Quote: ... 12 μL of 10 mg/mL Bovine Serum Albumin (100 × BSA, NEB), 5 μL of 400 U/μL T4 DNA Ligase (NEB #M0202) ...
-
bioRxiv - Microbiology 2019Quote: ... verticillioides with the primers FvGbb2-GFP-F/R using Q5® High-Fidelity DNA Polymerase (NEB: M0491S). The DNA fragment was introduced to the pKNTG plasmid KpnI and HindIII sites via In-Fusion-HD cloning kit (Takara Bio USA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mutant env gene was amplified from pTZ57/R-env plasmid pools using Phusion DNA Polymerase (NEB) and primers from 5’ and 3’ ends ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were recovered in SOC outgrowth medium (NEB B9020S) for 1 hour at 37°C before selection on kanamycin plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 950 μl SOC outgrowth medium (#B9020S, New England Biolabs) was added and sample was incubated on rotation at 37 °C for 1h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in SOC medium (NEB #B9020) at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 2mL of 37°C SOC Recovery Medium (NEB #B9020) were added to the cuvette ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Following one-hour outgrowth in SOC medium (NEB #B9020) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and sometimes included up to 0.01 mg/mL bovine serum albumin (B9000S, NEB) to limit enzyme adsorption to pipettes and tubes ...
-
bioRxiv - Microbiology 2022Quote: ... and 300 ng bovine serum albumin (BSA; New England BioLabs Inc. Ipswitch, MA), to which nuclease-free H2O was added to reach a volume of 25 µl ...
-
bioRxiv - Genomics 2020Quote: ... 10 µL of 2% bovine serum albumin (New England Biolabs, cat. no. B9000S), 0.3 µL of 1M spermine (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 0.464 μg/μL bovine serum albumin (BSA, New England BioLabs Inc. Ipswich, Massachusetts), and 1.5 mM of MgCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µl 10 mg/ml bovine serum albumin (BSA; New England Biolabs Ltd.), 1 µl T4 DNA ligase (2000U ...
-
bioRxiv - Genomics 2019Quote: ... Pools were PCR amplified using 10uM Illumina primer pair (F+R) and 2X Phusion Master Mix (NEB #M0531), temperature cycling consisted of 98°C for 30s ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Genetics 2023Quote: ... The T7 promoter and mtdTomato CDS were amplified from pmrPTRE-AAV using PTRE_floxed_F/R and Phusion High-Fidelity PCR Master Mix (NEB). NotI and SalI sites added by the primers were used to subclone this amplicon into pRM1506_TMM432 ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Microbiology 2023Quote: ... U6-del-F and U6-del-R (Supplementary table 4) were annealed and phosphorylated using T4 PNK (NEB) and ligated into the restricted plasmid using T7 DNA ligase ...
-
bioRxiv - Molecular Biology 2020Quote: ... 450 µl of pre-warmed SOC outgrowth medium (NEB B9020S) was added and the transformation was incubated at 37C with shaking (250 RPM ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 μg of 32P-labelled R-loop-containing plasmid was either mock-treated or incubated with 0.5 U RNase H (NEB) in 75 mM KCl / 50 mM Tris-HCl pH 7.5 / 3 mM MgCl2 / 10 mM DTT in a 20 μL reaction volume for 30 minutes at 37 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Neuroscience 2023Quote: Tail tip genomic DNA was PCR amplified with ATRX_RC gen F and ATRX_RC gen R primers and digested with FspI (NEB R0135S). FspI cuts the wild-type allele (product sizes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... long overlapping primers tRNA-fMet-C1G_temp F and RNA-fMet-C1G-A_temp R (Extended Data Table 1) were PCR amplified using Q5 DNA polymerase (NEB). Products were gel purified and amplified using short primers tRNA-fMet-C1G_amp F and tRNA-fMet-C1G-A_amp R (Extended Data Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ompT lacZ::T7.1 gal sulA11 ∆(mcrC-mrr) 114::IS10 R(mcr-73::)miniTN10(TetS) endA1 [dcm]) (New England Biolabs) was used for protein expression and purification.
-
bioRxiv - Biophysics 2020Quote: ... The flow cell was then treated with bovine serum albumin (BSA, New England Biolabs) (100 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Bovine serum albumin at final 0.2 mg/mL and Phi29 polymerase (New England BioLabs) were added and the reaction ran at 30°C for 16 hours before inactivation at 65°C for 10 minutes.
-
bioRxiv - Biophysics 2019Quote: ... The flow cell was then treated with bovine serum albumin (BSA, New England Biolabs) (100 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg bovine serum albumin (BSA) and 8 units Phi29 DNA polymerase enzyme (NEB). Amplification reactions were monitored for 5 hours at 30 °C in MicroAmp fast reaction tubes with cap (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... cloned into the pJR16 vector in two steps (Gift from R. Johnston, Johns Hopkins University) using HiFi DNA Assembly (New England Biolabs). pJR16 uses an EGFP reporter with a nuclear localization sequence (nls) ...
-
bioRxiv - Cell Biology 2020Quote: To prepare single guide RNA targeting MTFR2, DNA oligoes (F: CACCGACGACATTTACCTGTTCTAC, R: AAACGTAGAACAGGTAAATGTCGTC) were annealed and cloned into BsmBI (NEB) cut pLenti-sgRNA to make pLenti-sgMTFR2 following published protocols (Ran ...
-
bioRxiv - Biochemistry 2020Quote: ... Modification of the coding sequence of the multibasic S1/S2 cleavage site PRRAR to PGSAS or to a single R was carried out by PCR mutagenesis using Q5 polymerase (New England Biolabs). Introduction of cysteine crosslinks and modification of residues 986 and 987 were carried out using Q5 polymerase PCR with primers containing desired substitutions ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... a 2.4-kb PCR fragment spanning Rv3377c-Rv3378c was generated using primers BamHI-Rv3377c-Rv3378c-F and HindIII-Rv3377c-Rv3378c-R (Sup. Table 1) using high-fidelity Phusion DNA polymerase (New England Biolabs). The fragment was subsequently digested with BamHI and HindIII (all restriction enzymes from New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... This fragment was PCR-amplified with the oligonucleotides 89.F lambda 40002 XhoI and 90.R lambda 45263 ApaI using Lambda DNA (NEB) as a template ...
-
bioRxiv - Genetics 2021Quote: ... 5’TTGGNNN…NNNGTTTAAGAGC3’and Oligo R: 5’TTAGCTCTTAAACNNN…NNNCCAACAAG3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB).
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Genetics 2020Quote: ... the ‘T2A-GFP-WPRE’ sequence was amplified from the hVMD2-hBEST1-T2A-GFP plasmid using LCv2-GFP.Gib.F and .R primers and Q5 2X MM (NEB, Cat# M0492L). The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Candidate founders giving positive products in all three PCR reactions were further characterised by amplifying again with the JG01 F/R primers using high fidelity Phusion polymerase (NEB), the larger product gel extracted and subcloned into pCRblunt (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... 10μg of undigested total RNA samples and the above-mentioned RNase R-treated RNA were added with RNA loading dye (NEB) and denatured for 10min at 70°C ...
-
bioRxiv - Biochemistry 2023Quote: ... with the Metadynminer R package.52 Minimum free energy paths (MFEPs) were obtained through the Metadynminer package with the nudged elastic band (NEB) method linking intermediate wells.53 Concerted pathways were obtained by NEB directly from the reactants to the products ...
-
bioRxiv - Cell Biology 2023Quote: ... zact sequence was amplified with primers containing attB sites (F: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGATGAGGAAATCGCTG; R: GGGGACCACTTTGTACAA-GAAAGCTGGGTAGAAGCACTTCCTGTGGACGATG) using a high-fidelity polymerase (Phusion, NEB). To create a middle entry clone pME-zact ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB). The insert was ligated to the vector in a 3:1 ratio (insert:vector ...