Labshake search
Citations for New England Biolabs :
1 - 50 of 8949 citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... with or without DMSO (NEB), and the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were prepared without rRNA depletion using NEBNext Ultra II Directional RNA Library kit (NEB) with the following modifications ...
-
bioRxiv - Genetics 2020Quote: ... without modification except for library preparation performed with NEBNext® Ultra kit (New England Biolabs®). For library preparation 600 ng of each genomic DNA were fragmented by sonication and purified to yield fragments of 150-200 bp ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins with or without PNGase F (NEB, USA) digestion were mixed with the loading buffer (250Mm Tris-HCl PH 6.8 ...
-
bioRxiv - Genomics 2024Quote: ... Large (Klenow) fragment without exonuclease activity (exo-) (NEB) in combination with dATP or dGTP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... while Gibson assembly reactions used the NEBuilder(R) HiFi DNA Assembly Cloning Kit (NEB). Transformed bacteria were grown for 24h at 32°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Controls were handled with same protocol without λ-phosphatase (NEB). Phospho-mass spectrometry was performed as previously described (Nagai et al. ...
-
bioRxiv - Microbiology 2020Quote: ... with or without prior digestion with DpnI (New England Biolabs), were analyzed on 0.8% agarose gel followed by Southern blotting using a 32P-labeled DNA probe specific for AAV2 rep (for detection of wtAAV2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... with or without addition of murine RNase inhibitor (RI, NEB). Intracellular tRNA-derived fragments were generated by exposing cells to 500 µM sodium arsenite (Sigma ...
-
bioRxiv - Pathology 2021Quote: ... Sequencing libraries were generated using NEBNext R UltraTM RNA Library Prep Kit (Illunina, NEB, United States) and the library quality was assessed on the Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Microbiology 2021Quote: ... The first EcoRI restriction site at 829 bp within the AgeI and KasI restriction sites in RGD4C-AAVP-TNF was deleted in two steps to mutate a thymidine to cytosine nucleotide at position 833 without altering the translated amino acid using the Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA) by following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... SCAR-seq libraries were prepared following the previous published protocol (11) without any modification except using NEBNext® Ultra™ II DNA library prep kit (NEB) for the end repair ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were labelled by replacing complete growth medium with 500 μl serum free DMEM/F12 containing 200 nM SNAP Surface Alexa Fluor-488 (New England Biolabs) and were incubated for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed with PBS and the cells were incubated in 1ml serum free medium and 250U/ml PNGase F (NEB, P0704S) for 6h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1600 v/10 ms /3 pulses for 200,000 cells in Buffer R (Neon Transfection kit) premixed with 50 pmol Cas9 protein (CAT#M0646T, New England Biolabs), 50 pmol single guide RNA (sgRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The eluted DNA was incubated with or without RNase H (New England Biolabs) at 37 °C overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol) with or without 50 µM ATP (P0756S, New England Biolabs) at 30°C for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15μL of myc-eIF6-bound beads were incubated with/without recombinant GSK3β (NEB) and suspended in cold kinase buffer and incubated at 30°C for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... EGFP-Sec22b-shR and EGFP-Sec22b-P33-shR were generated by site-directed mutagenesis (F: CTTCTGAATGAAGGTGTCGAACTCGATAAAAGAATAAGGCCTAGACACAGTGGGC; R: GCCCACTGTGTCTAGGCCTTATTCTTTTATCGAGTTCGACACCTTCATTCAGAAG) using the Q5 Site-Directed Mutagenesis Kit (NEB). pEGFP-ORP8-H514A-H515A (ORP8-Mut ...
-
bioRxiv - Biophysics 2023Quote: ... The samples were mixed with 6 × purple loading dye without sodium dodecyl sulfate (NEB) and with 10 × TBE to make a 1 × solution ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.1% BSA) with or without Short Cut RNase III (New England Biolabs; 1:150) for 90 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... Mutagenic PCR to obtain the D614G amino acid change into both untagged and 161/345A4-tagged SΔTM constructs was done using the primers S2_D614_Q5-F and S2_D614_Q5-R (Table S1) and the Q5® Site-Directed Mutagenesis Kit (NEB®, Ipswich, MA, USA) according to the manufacturer instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Association occurred in samples containing ACE2- fusion proteins either without or with TEV protease (NEB) treatment ...
-
bioRxiv - Bioengineering 2020Quote: ... we use Western Blot to detect spike protein with/without treatment of PNGase F (NEB). 100 ng particles were incubated with Glycoprotein Denaturing Buffer at 98°C for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were mixed with a 6X loading buffer without SDS and reducing agents (BioLabs, B7025S) and without boiling loaded onto Native-PAGE gels (NativePAGE ...
-
bioRxiv - Microbiology 2022Quote: ... 100 ng of DNA was treated with or without 6.6 units of ExoV (RecBCD, NEB) in a 10 µl reaction volume and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... and equivalent amounts of Hirt DNA were digested with or without DpnI (New England Biolabs) and analyzed on a 0.8% neutral agarose gel followed by transfer to a nitrocellulose membrane ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... g165 and g166 without the predicted signal peptides were PCR-amplified with Phusion polymerase (NEB) from genomic DNA of P ...
-
bioRxiv - Cell Biology 2022Quote: ... cleared lysate was incubated without or with PNGase F (NEB, 1 μl per 40 μl lysate) for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... a master mix was prepared containing 2 µl 10x T4 polynucleotide kinase buffer without ATP (NEB) and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201 ...
-
bioRxiv - Cell Biology 2019Quote: ... Excess bead primers without RNA molecules were removed by the treatment of Exonuclease I (NEB, NEBM0293S). Then ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Synthetic Biology 2020Quote: Purified RNA was reverse-transcribed with MuLV-R (NEB) and Random Primer Mix (NEB ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with primers AAVS1_CAG_fl_STOP_fl_F & R to introduce MluI (NEB, R3198S) and KpnI (NEB ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant condensin II holo(WT) at 500 nM was mixed with or without λ protein phosphatase (NEB) at a final concentration of 400 U/µL in 1x NEBuffer for Protein MetalloPhosphatases supplemented with 1 mM MnCl2 and incubated at 30°C for 60 min ...
-
bioRxiv - Biochemistry 2021Quote: ... with and without the addition of ACE2 (~1:1.25 S-protein trimer:ACE2 molar ratio) (New England Biolabs). Vitrified samples of S-protein constructs with and without ACE2 were prepared by first glow discharging Quantifoil R1.2/1.3 300 mesh holey carbon copper grids for 1 minute using a Pelco easiGlow glow discharge unit (Ted Pella ...
-
bioRxiv - Biochemistry 2021Quote: ... the denatured samples were incubated at 37 °C with or without Endo Hf (P0703S, New England Biolabs) or PNGase F (P0704S ...
-
bioRxiv - Molecular Biology 2023Quote: The coding sequence of PolA without the start codon was amplified by PCR using Q5 polymerase (NEB) and cloned BamHI-XhoI into pET28a (Thermo ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO21-92 and ISG1579-156 without tag and subsequently cloned into the pTXB1 vector (New England Biolabs) by restriction cloning according to the manufacturers protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... bovine serum albumin (New England Biolabs) and buffer served as negative controls ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digested bovine serum albumin (NEB, P8108S) was analysed between each sample to avoid sample carry-over and to assure stability of the instrument and QCloud (45 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: Digested bovine serum albumin (P8108S, NEB) was analyzed between each sample to avoid sample carryover and to assure stability of the instrument and QCloud has been used to control instrument longitudinal performance during the project (57).
-
bioRxiv - Molecular Biology 2022Quote: ... Two 100 μl aliquots were incubated overnight at 37°C with and without Endo H (3000 U, NEB). Then the samples were heated with 100 μl SDS sample buffer for 5 min at 95°C.
-
bioRxiv - Cell Biology 2022Quote: ... with or without phosphatase addition (0.25 μL of 11 phosphatase in 50 μL reaction volume, New England Biolabs, P0753 or 200 nM purified 6xHis-Calcineurin ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...