Labshake search
Citations for New England Biolabs :
401 - 450 of 700 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... and PE 2.0 (5′-CAA GCA GAA GAC GGC ATA CGA GAT CGG TCT CGG CAT TCC TGC TGA ACC GCT CTT CCG ATC* T-3′) for 15 cycles using Phusion polymerase (NEB M0530S). The library was purified by electrophoresis on a 1.2% agarose gel to get rid of adapter dimers ...
-
bioRxiv - Cell Biology 2020Quote: ... photoactivatable-mCherry was PCR-amplified from the plasmid N-PA-mCh and assembled into the retroviral vector pBABE-puro using HiFi DNA Assembly (E5520S, NEB). To create the stable U2OS-dCas9-PA-mCh/GFP-Parkin and U2OS-dCas9-PA-mCh/TFEB-GFP cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... The amplicons were cloned into PCR-linearized pPR3-N prey plasmid (Dualsystems Biotech) at the SfiI sites using the NEBuilder HiFi DNA Assembly Kit (New England Biolabs), and were transformed into DH5α competent cells and plated onto 48-well Bioassay Qtrays (Molecular Devices) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Biochemistry 2019Quote: ... and cloned into a modified pOEM vector as HRV 3C-cleavable N-terminal GST fusion construct (GST-C1-GFP-NES) using the restriction enzymes NotI and AscI (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... A 12xHis tag was cloned into the N-terminus of pcDNA3.1-MICAL1-FLAG using Q5® Site-Directed Mutagenesis Kits (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: AcpP was expressed from a pET28a plasmid encoding acpP with a thrombin-cleavable N-terminal 6xHis tag in C3031I cells (NEB). 2L cultures of LB supplemented with kanamycin (25 μg/mL ...
-
bioRxiv - Biochemistry 2020Quote: 20 μg of protein from SK-RC-39 cells were treated with N-glycosidase F (PNGase F) and Endoglycosidase H (Endo H) (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Engineered SiR vectors carrying d.C1349G or d.G1357T PEST-targeting mutations were produced by PCR amplification of the Rabies genome in 2 fragments starting from the end of N assembled using Gibson master mix (NEB).
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the pZE13d vector (Lutz and Bujard, 1997) with an N-terminal 6xHis tag via Gibson assembly (Hifi DNA Assembly, NEB) using ClaI and PstI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... open reading frames were cloned into a linearized pET28b vector with BamH1 and Xho1 in frame with a N- terminal 6x-His tag using Gibson HiFi assembly mix (NEB), 10 μL total reaction volume with 2 μL of linearized vector ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The exact same purification scheme for DDX5(1-535)-SNAP was used to purify DDX5(1-483)-SNAP and the protein was flash frozen in medium salt storage buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: The full-length African killifish DDX5 was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). E ...
-
bioRxiv - Neuroscience 2022Quote: ... was cloned into the pDEST17 vector containing an N-terminal His10-Smt3-tag and a C-terminal SNAP-tag (New England BioLabs). The same purification scheme was used to purify DDX5(1-535)-SNAP than DDX5-SNAP ...
-
bioRxiv - Cell Biology 2022Quote: ... KLC sequences comprising residues 1-155 of murine KLC2 and residues 1-162 or 163-538 of murine KLC1A were amplified by PCR and cloned into the NotI/EcoRI site of the pEL N-term GFP parental vector using Gibson Assembly (New England Biolabs) following the manufacturer’s instructions (Rietdorf et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and both inserted between the XhoI and EcoRI sites of the parental pLVX N-term GFP vector using Gibson Assembly (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... was fused to an HA-tag at its N-terminus during PCR and cloned into the lentiviral vector pLJM1 linearized with AgeI (NEB) and EcoRI (NEB ...
-
bioRxiv - Biophysics 2019Quote: ... was generated as a fusion construct with N-terminal maltose binding protein (MBP) as we described previously (45) using the pMAL-c2x (New England Biolabs) variant pMALX (46) ...
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Genomics 2021Quote: The AID N-terminal AID-RPB1 vector was assembled by Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB, E2621L) in the pENTR221 kanamycin vector using the following templates ...
-
bioRxiv - Biochemistry 2021Quote: ... using a plasmid that codes for the desired protein sequence fused to an N-terminal intein and chitin binding domain (CBD) as part of the IMPACT purification system (NEB). 2 liters of cells were grown to an OD600 of 0.6 and induced with 1 mM IPTG for 3 hours at 25 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The fragment of sNTurboID was PCR amplified from pLX304 CMV FKBP-V5-sTurboID (N) and cloned into the pcDNA5-VP35-HA using NEBuilder HiFi DNA Assembly Master Mix (NEB). The fragment of VP35-sNTurboID ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added to each quadrant of the 96-well plate (n = 24 unique adapters) with a ligation mixture of 40 Weiss U T4 ligase (NEB), 1mM ATP (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were introduced in the P and N sequences by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Genetics 2020Quote: ... An 18-mer poly-N barcode was created by annealing primers (Table S1) and extended to make fully double stranded with Klenow polymerase (NEB). The barcode was then PCR purified (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9 were performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the ELO genes were inserted using the primers described in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... and Atd1 and containing an N-terminal TEV cleavage site were cloned directly via Gibson assembly (NEBuilder HiFi, New England Biolabs) into BamHI/NotI-digested pGEX4-1 (GE Healthcare) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into a gel-purified N-terminal sub-cloning vector digested with MluI and KpnI restriction enzymes (New England Biolabs). Cas13 C-terminal fragments were also PCR amplified out of the full Cas13 sequence templates mentioned above to contain a 5′ sequence to code for the KpnI restriction site a start codon ...
-
bioRxiv - Cell Biology 2023Quote: ... was fused in frame to the N-terminus of LRRK2 between the PreScission recognition sequence and NotI restriction site using HiFi assembly (NEB). A plasmid encoding Rab8 was previously generated in the De Camilli lab.
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... double and triple N>G mutations were introduced in the parental constructs by using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturers protocols and using custom designed primer ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Molecular Biology 2022Quote: The NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB #E7370S/L) was used to prepare DNA sequencing libraries ...
-
bioRxiv - Microbiology 2023Quote: ... NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645S/L) was used for library preparation and libraries were sequenced on Illumina MiSeq or NextSeq 2000 platform and more than 1.25M read pairs of 150bp length were generated per sample i.e ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 ng of mRNA was decapped using either tobacco acid pyrophosphate (250 U; Epicenter) or RppH (NEB) in buffer provided by the supplier and then dephosphorylated by Antarctic phosphatase (NEB) ...