Labshake search
Citations for New England Biolabs :
601 - 650 of 700 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 20 µl of 2 U/µl Phusion polymerase and 160 µl of 40 U/µl Taq ligase (all enzymes from NEB). ddH2O was then added to a final volume of 1.2 ml.
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Physiology 2022Quote: ... 1 L of diluted extracts were incubated with 9 ml of packed amylose resin (catalog no. E8021S, New England Biolabs) and incubated at 4°C for 2h with gentle rotation ...
-
bioRxiv - Developmental Biology 2022Quote: Full-length cDNAs for wnt11b.L were amplified from wildtype or wnt11b-/- mutant oocyte total RNA using a high-fidelity polymerase (Q5, New England Biolabs). PCR products were cloned into pCR8/GW/TOPO (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... End-repair reaction was cleaned using 1.8X Agencourt AMPure XP beads and eluted in 15 µl of EB that was used for A-tailing reaction in 30 µl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 units of Klenow fragment exo- (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... End-repair reaction was cleaned using 2X Agencourt AMPure XP beads and eluted in 16.5 μl of EB that was used for A-tailing reaction in 20 μl of NEBNext dA-Tailing reaction buffer (NEB) with 7.5 U of Klenow fragment exo-(NEB ...
-
bioRxiv - Genomics 2019Quote: ... We prepared D3839 libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645S/L) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... We prepared WT libraries using the NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs: E6040S/L) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 0.2 μl 50x oligos (AarI recognition site) for Level 0 and Level 2 cloning or Eco31I/BsaI-HFv2 (ThermoFisher Scientific/NEB) for Level 1 cloning ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were carried out in 10 μl of the purified components from the PURExpress In Vitro Protein Synthesis Kit (E6800S/L, NEB) with the corresponding templates ...
-
bioRxiv - Biochemistry 2019Quote: ... The digested PCR product was circularized by T4 DNA ligase in a total volume of 500 μL 1x T4 DNA Ligase Reaction Buffer containing 100 μL digested PCR product and 10 kU T4 DNA Ligase (NEB). The reaction was incubated overnight at 16°C and purified by ethanol precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... The L-sNTurboID fragment was ligated back to the pCEZ-L backbone using the same restriction sites Pac1 and Hpa1 by NEB T4 ligase.
-
bioRxiv - Genomics 2020Quote: ... Each reaction is performed in 50 μl at 30°C overnight with 2 μl of circulated DNA with 2.5 μL of 10 μM (each) dNTPs (Catalog number: N0446S Vendor: New England Biolabs Inc), 2.5 μL Rolling cycle primer (10 μM) ...
-
bioRxiv - Microbiology 2021Quote: ... We then used a 1690 bp synthetic fragment (gBlock Gene Fragments from IDT) containing the digested L gene sequences and EGFP to be inserted by Gibson Assembly (NEBuilder HiFi DNA assembly, NEB). The gBlock contained mutations to replace nucleotides CT at rCDVRIVenus(6 ...
-
bioRxiv - Immunology 2021Quote: ... 10 μl of the eluted PCR product was used in a final indexing using NEBNext Multiplex Oligos for Illumina (E7710S, NEB) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the plasmid DNA served as template for a 50 µl PCR (Q5 High-Fidelity 2X Master Mix, NEB) with primers PK412+PK421 (input library ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were pelleted by centrifuging at 500 g for 5 min at 4 °C and resuspended in 200 μl 1X NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA; NEB, B7202) in a 1.5 ml tube ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of indexed P7 (Cao et al., 2017) and 20 μl of NEBNext High-Fidelity master mix (New England Biolabs) were added to each well and PCR performed as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) following the kit protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Homology arms were cloned into pKLM73 for mNeonGreen and pKLM110 for mScarlet (gifts from Kara L. McKinley) using NEBuilder HiFi DNA Assembly (New England Biolabs). To generate knock-in lines ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from 5-10 µl of the cell scrape and prepared for sequencing using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL of ligation reaction mix was prepared (1X ligation buffer, 5 units of T4 RNA ligase I (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µl of the Dpn I digested amplification product was transformed into 25 µl of NEB turbo competent E.coli (NEB, C2984). The desired mutation was initially confirmed by Sanger sequencing (Genomics Core Facility (UPF ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Immunology 2021Quote: ... Master mix preparation and cycling conditions were realized with Luna® Universal qPCR Master Mix kit (cat. n° M3003E, NEB, New England Biolabs, Ipswich, MA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... The bound protein (~42kDa, 360 amino acids) was released from the MBP tag by cleavage with Factor Xa (New England Biolabs, Massachusetts, United States) for 24 hours at 4°C in 20mMTris pH 7.2 ...
-
bioRxiv - Zoology 2023Quote: Reverse transcription was conducted with 10 µL of eluted nucleic acids using the ProtoScript® II Reverse Transcriptase (New England Biolabs, Massachusetts, USA). For each sample ...
-
bioRxiv - Genetics 2021Quote: ... 1μl XhoI digestion mix consisting of 5U XhoI restriction enzyme and 1 x NEB buffer 2.1 (New England Biolabs, Ipswich, Massachusetts), and 10 ng genomic DNA for iciHHV-6B samples or 200 ng DNA for non-iciHHV-6B samples.
-
bioRxiv - Microbiology 2021Quote: ... A screen for clones containing an insert into pBAD33 was carried out using 1 μl of this suspension as a PCR template using primers oMJD204 and oMJD205 and OneTaq Quickload 2X Master Mix (NEB, #M0486S), according to the manufacturer’s instructions (annealing temperature 45 °C ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... μl of eluted DNA from the previous digestion in 1x final concentration CutSmart buffer with 20 U SphI-HF (NEB R3182S). Digestion was carried out for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of genomic DNA was used as template in a 40 μL PCR reaction with LongAmp® Taq DNA Polymerase (NEB). The 415bp PCR fragment of white target was amplified with CGTTAGGGAGCCGATAAAGAGGTCATCC (w.sF ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq libraries were built using the NEB Next UltraII DNA library Prep kit for Illumina (New England Biolabs #E7645S/L) and Agencourt Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Systems Biology 2022Quote: For INO80 replicate 1 and both input samples 20 μl of the eluted DNA was incubated with 30 μl of end-repair mix (0.66 mM dNTP mix (NEB, cat. # N0447S), 100 U/ml T4 DNA polymerase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 sorted cells were collected into individual wells of 96-well plate containing 5 μl of lysis buffer of NEB Next single-cell low input RNA library prep kit for Illumina (New England Biolabs #E6420). Plates were frozen immediately on dry ice and stored at −80 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 2.5 µl 25 µM Custom Nextera PCR Primer 2 and 25 µl NEB Next High Fidelity 2x PCR Master Mix (NEB, #M0541) with 1 cycle of (72°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of 10x SSS buffer and 1 μL of SSS Enzyme (NEBNext mRNA Second Strand Synthesis Module, New England Biolabs, USA) were added to the 17 μL of the purified sample ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplifications were done in 5 μL volumes in a 384-format PCR plate using Q5® Hot-Start High-Fidelity 2x Master Mix (New England BioLabs, 2.5 μL per reaction for 1x concentration ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of S2R+ or fly genomic DNA was used in a PCR reaction using Q5 High-Fidelity DNA Polymerase (NEB M0491L). Primer pairs (Supplemental File 2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 50 μl of 10X NEB Buffer 2 and 375 U (15 μl of 25 U/ μl) of MboI restriction enzyme (NEB, R0147), and digest chromatin for 2 hours at 37°C with rotation ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Microbiology 2022Quote: ... Purified RNAs were used for library preparation using the NEB Next Multiplex Small RNA Library Prep kit for Illumina (E7300 L) with Universal miRNA Cloning Linker from Biolabs (S1315S) as the 3’ adaptor and in-house designed indexed primers ...