Labshake search
Citations for New England Biolabs :
401 - 450 of 9031 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the Gemini 1.0 plasmid underwent in vitro transcription using T7 RNA polymerase (NEB, M0251L), followed by in vitro 5’ capping and 3’ polyadenylation ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription was carried out using 10µM oligo dT primer and MMLV RT (NEB) according to the manufacture protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... The reverse transcription reaction mix (1x RevertAid RT buffer, 250 μM dNTPs (NEB N0447L), 0.2 mg/mL recombinant albumin (NEB B9200S) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal amounts of RNA were transcribed with reverse-transcription (M-MuLV Reverse Transcriptase, NEB). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transcription was performed with dT priming using the ProtoScript II RT (NEB M0368L) as described by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Biophysics 2020Quote: ... from human origin were all purchased from NEB. The H2A/H2B and H3.1/H4 were mixed in 2(H2A/H2B)2:1(H3/H4)4 molar ratio to form octamers.
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixed RNA was depleted of rRNA using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) and fragmented using NEBNext® Magnesium RNA Fragmentation Module (NEB, cat. no. E6150S) for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: 30 uL of tagged Fluc-WT proteins were incubated with Factor Xa (NEW ENGLAND BioLabs, final concentration 67 ug/mL) for 2 hours or overnight on ice.
-
bioRxiv - Developmental Biology 2020Quote: ... the concentration of eluted MBP-mintbody was adjusted to 1 mg/ml and digested with 30 μg/ml Factor Xa (New England Biolabs) for 24 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribosome concentrations were calculated with a NanoDrop spectrophotometer assuming 1A260 = 60 μg ribosome mL−1 (conversion factor provided by New England Biolabs). This conversion factor was used to estimate the molecular mass of bacterial ribosomes ...
-
bioRxiv - Immunology 2023Quote: ... The resulting proCLIPB4-6His-pFastBac1 plasmid was used as a template to produce the mutant proCLIPB4Xa-6His-pFastBac1.To utilize commercial Factor Xa (New England Biolabs), the predicted activation site LTDR107 of proCLIPB4 was replaced with IEGR107 ...
-
bioRxiv - Genomics 2024Quote: Each of the fragmented protein factor-enriched chromatin sample was mixed with 50 µg/ml of BSA (cat# B9000S, NEB) to prevent chromatin aggregation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We first produced the DNA-template for T7-transcription using PCR with Taq polymerase (NEB) and primers 11 ...
-
bioRxiv - Bioengineering 2021Quote: ... The cDNA was synthesized using Lunascript reverse transcription master mix (New England Biolabs, Ipswich, MA). Collagen type 1 alpha 1 (COL1A1) ...
-
bioRxiv - Biochemistry 2019Quote: ... The sgRNAs were prepared by an in vitro transcription using T7 RNA polymerase (M0251S, NEB). The sgRNA transcription template was prepared by PCR amplification of sgRNA-coding sequence cloned in the sgRNA expression plasmid (pEASY-csgRNA ...
-
bioRxiv - Biochemistry 2019Quote: RNase-treated transcription reactions involved incubation with 2.5 units of RNase H (New England Biolabs), 2.5 units of RNase I (Promega) ...
-
bioRxiv - Physiology 2019Quote: ... In vivo transcription was carried out using the RNA polymerase SP6/T3 (#M0378S/M0207S, NEB) followed by template DNA degradation using DNAseI (#M0303S ...
-
bioRxiv - Molecular Biology 2021Quote: RNA constructs were made by in vitro transcription with T7 RNA polymerase (New England Biolabs) as previously described50 ...
-
bioRxiv - Genomics 2022Quote: ... The PCR products were used as the template for in vitro transcription (NEB, Cat. E2040S) followed by reverse transcription (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... transcription template was generated by PCR using Q5 high fidelity DNA polymerase (New England Biolabs) with dNTP (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs with a random region of 40nt were prepared by in vitro transcription (NEB, E2040S) using the dsDNA as template ...
-
bioRxiv - Molecular Biology 2023Quote: ... or uncapped U1 snRNAs were produced by in vitro transcription using T7 RNA polymerase (NEB). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA substrates were synthesized by run off in vitro transcription (IVT) using T7 polymerase (NEB) in the presence of [α-32P]-UTP according to the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription was performed on 0.5 µg DNase-treated total RNA using Lunascript RT (NEB) in 20µl reactions ...
-
bioRxiv - Biophysics 2023Quote: ... PCR was used to amplify templates for in vitro transcription with T7 RNA polymerase (NEB). The RNA product was extracted with phenol and concentration was measured by Nanodrop spectrophotometer (Thermo Fisher) ...
-
bioRxiv - Genetics 2024Quote: The puromycin targeting sgRNA was synthesized by in vitro transcription using T7 RNA polymerase (NEB) and template oligos ...
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... Human plasma was treated with PNGase F (NEB; P0704S) or a mixture of O-Glycosidase (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... as with commercially available human H1 (hH1) (M2501S; NEB), sharing 96.5% identity with mH1 (Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... and human casein kinase II (New England BioLabs, #P6010).
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and a maltose binding protein (MBP) (65) and Factor Xa sequence derived from pMAL-c5X vector (New England Biolabs, Ipswich, MA) with a V313A mutation to be consistent with the native E ...
-
bioRxiv - Cell Biology 2022Quote: ... which was incorporated into the TMD by amber stop codon suppression in the PURExpress system lacking all release factors (ΔRF123; New England Biolabs, USA). The release factors RF2 and RF3 ...
-
bioRxiv - Developmental Biology 2020Quote: Double-stranded RNA (dsRNA) was produced by simultaneous transcription with T7 RNA polymerase (New England Biolabs) on PCR products containing T7 promoter sequences (CGACTCACTATAGGG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biochemistry 2021Quote: AdML IVS1 was synthesized by run-off transcription and treated with DNase I (New England Biolabs). For chromatographic purification ...
-
bioRxiv - Bioengineering 2021Quote: ... The purified template DNA was mixed with an in vitro transcription mixture [T7 RNA polymerase (NEB), 50 mM MgCl2 ...
-
bioRxiv - Bioengineering 2020Quote: ... The post-transcription reaction mixture was incubated with 10 units of DNase I (New England Biolabs) at 37°C for 1 hour to remove the gblock template then purified using a RNA spin column (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Complementary DNA (cDNA) was prepared by reverse transcription with AMV reverse transcriptase (New England Biolabs, MA) with primers TCAGCATGCCTCATTCCAAC (MA0659 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Genetics 2020Quote: ... The guide RNA was synthesized by in vitro transcription with T7 RNA polymerase (New England Biolabs). The oligonucleotide templates (10 ng/μL) ...
-
bioRxiv - Plant Biology 2022Quote: Reverse transcription was performed using 2 µg of total RNA and M-MuLV Reverse Transcriptase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro coupled transcription-translation was performed in PURExpress™ (New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Reverse transcription and cDNA synthesis were performed using NEBNext® RNA First Strand Synthesis Module (NEB). Transcript quantification was carried out using Stratagene MX3000P real-time PCR detection system (Agilent Technologies ...