Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Cow Ataxin 10 ATXN10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Up to 10 ng of cDNA was used for the Illumina sequencing library construction using NEBNext Ultra DNA Library Prep Kit (NEB, E7645). Paired ends sequencing was performed on NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: ... Up to 10 ng of DNA was used for the library construction using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645). Sequencing was performed on NextSeq500 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 200 ng of sheared gDNA and 10 PCR cycles using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S). The DNA libraries were indexed with unique dual barcodes (8bp long) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Genomics 2022Quote: ... from ONTs ligation sequencing kit (ONT, SQK-LSK109) and 10 µl of NEBNext Quick T4 DNA Ligase (New England Biolabs, E6056S). Ligation mix was incubated at RT for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... was used as a template to prepare 10 μl cDNA using LunaScript®RT SuperMix Kit (New England Biolabs, cat# E3010L) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared with 10 ng of total RNA using NEBNext® single cell/low input RNA library preparation Kit (New England Biolabs). Single-end sequencing was performed on all the samples with a 75 bp sequencing depth on a NextSeq machine at the RNomics platform of the Université de Sherbrooke (Canada) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Up to 10 ng of DNA was used for the library construction using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645). Sequencing was performed on NextSeq 500 (Illumina).
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μg of linearized plasmid was used as template in a 10 µL reaction using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) with an 8:1 ratio of cap analog to GTP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng of DNA was used for library preparation according to NEBNext® Ultra II DNA Library Prep Kit (NEB, E7645S). Purity and size distribution of the libraries were estimated using Fragment Analyzer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng of DNA was used for library preparation according to NEBNext® Ultra II DNA Library Prep Kit (NEB, E7645S). Purity and size distribution of the libraries were estimated using Fragment Analyzer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng of DNA was used for library preparation according to NEBNext® Ultra II DNA Library Prep Kit (NEB, E7645S). Purity and size distribution of the libraries were estimated using Fragment Analyzer ...
-
bioRxiv - Genetics 2023Quote: ... cDNA and sequencing libraries were generated from 500 ng of fresh RNA samples with 10 cycles of PCR with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #7760). After quality checking using an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were carried out in 10 μL reactions using the Luna® One-Step Universal RT-qPCR kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from starter cultures of the three original ancestor isolates and 10 trimethoprim-resistant derivatives using New England Biolabs Monarch Genomic DNA Extraction Kit (New England Biolabs, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA/sgRNA/Cas9 ratios of 1/10/10 were used in a 10 µl reaction using the buffer supplied (NEB) and DEPC-treated water (Haussmann et al ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Physiology 2020Quote: RNA was extracted from cultured cells or tissue (∼10 mg) stored in RNALater® using Monarch® Total RNA Miniprep Kit (New England BioLabs). For maximal RNA recovery ...
-
bioRxiv - Microbiology 2021Quote: ... were cloned into the pCR-Blunt-II vector using the PCR Blunt Topo kit according to the manufacturer’s instructions and transformed into 10-beta CaCl2-chemically competent bacteria (originally NEB, generated in-house). Following amplifications of colonies and purification of plasmids using a QiAprep Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μL of factor mix (with RNA polymerase, and transcription/translation factors in 10 mM Mg2+) from the PURExpress® Δ Ribosome Kit (New England Biolabs). The reaction buffer was based on Shimizu et al ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were PCR amplified from genomic DNA of yeast strain BY474129 and cloned together with the bidirectional inducible Gal1-10 promoter into the PCR amplified pRSII42B backbone with OZL14 and OZL15 via Gibson assembly30 using NEBuilder Kit (NEB, catalog E2621). MMR-DN mutant genes were subsequently generated via site-directed mutagenesis using either Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and 10-12 day adult TRAP libraries were prepared with the NEBNext Ultra RNA library Prep Kit for Illumina (NEB, product E7530S). ChIP-seq libraries were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Up to 10 ng of cDNA was used for the Illumina sequencing library construction using NEBNext® Ultra™ DNA Library Prep Kit (NEB). Paired ends sequencing was performed on NextSeq 500 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and PCR enrichment of adapter-ligated DNA was performed for 10 cycles using NEBNext® Ultra™ DNA Library Prep Kit (New England Biolabs). Amplified libraries were purified with 0.7x SPRIselect beads and sequenced with MiSeq Reagent Kit v3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and pACG9-[EC1-10]) were generated through site-directed mutagenesis (NEB Q5 site-directed mutagenesis kit; New England Biolabs, Ipswich, MA, USA). Specifically ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we purified the products of the ace-1 PCR (see above) using the BS664-250 Preps EZ-10 Spin Column PCR Purification kit (New England BioLabs, Evry France). The purified PCR products were then cloned (TOPO TA Cloning Kit pCR 2.1-TOPO Vector and TOP10F’ invitrogen bacteria) ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared from 50 ng (hippocampi) or 10 ng (amygdalae) RNA using the NEBNext® Ultra™ II RNA Library Prep Kits for Illumina (New England Biolabs). Libraries were sequenced (40M bp sequencing depth ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Genomics 2020Quote: ... 2 μg of total RNA from various tissues was used to construct RNA-seq library and sequence on the Illumina HiSeq X-10 platform following the protocol of NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs Ipswich, MA, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... in a 10 μl reaction using 10 U T4 RNA ligase (New England Biolabs) in 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Genomics 2023Quote: ... 25 µl of 10×CutSmart Buffer and 10 µl of Hae III (NEB, #R0108L) were added to each tube ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μL RNAs were mixed thoroughly with 1 μL T4 PNK (10 U, NEB), 1 μL purified TS2126 and 1 μL PAP1 enzyme (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... coli (10-beta, NEB, C3020K) were thawed on ice and mixed with 6 µg of purified 3Cs-DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 U of HaeIII (NEB), and >0.1 pg of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli NEB 10-beta (NEB) was used for cloning ...
-
bioRxiv - Genomics 2021Quote: ... 10 μL buffer 3.1 (NEB) and ultrapure water to a final volume of 70 μL ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl DpnII (R0543M, NEB) (500 U per tube ...