Labshake search
Citations for New England Biolabs :
301 - 350 of 3577 citations for Collagen Alpha 1 XVIII Chain Endostatin Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... The remainder of the adapter sequences were added to the heavy and light chains separately by a two-step PCR reaction with Q5 using the NEBNext index primers (NEB) 98°C for 30s ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Genomics 2021Quote: ... The reactions were combined and 2.5 μL of the assembly reaction or a control reaction without amplicon were used to transform NEB5-alpha cells (New England Biolabs) to measure background assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Immunology 2021Quote: ... In-vitro-transcription was carried out using the Hi-Scribe RNA transcription kit (New England BioLabs). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrations measured using Qubit 1X dsDNA HS Assay) was treated with 5U of RNAse HI (NEB) in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ENTR and DEST vectors were generated using Gibson assembly (NEB Builder Hi-Fi DNA assembly #E2621S) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of His-PKR was dephosphorylated using 3,200 units of λ-PPase (New England Biolabs) in 200 μl reaction buffer (50 mM HEPES ...
-
bioRxiv - Plant Biology 2022Quote: ... The HIS tag was removed from the mature sequence of AgLTP24 with enterokinase (NEB, Evry, France) for 16 h at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Hi-C single-index library preparation was performed as previously described56 using MboI (New England Biolabs) restriction enzyme.
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Microbiology 2024Quote: ... Tags (6x His or HA) were introduced using site-directed mutagenesis with KLD enzyme mix (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Novel mutants of Ecm2 were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs; Ipswich, MA). All plasmids were confirmed by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Zip codes were then amplified by polymerase chain reaction (PCR) from 200 ng of DNA template using Phusion ® High-Fidelity (HF) DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... neon-Green and mScarlet, these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The genes of interest were amplified by polymerase chain reaction (PCR) using Q5 high fidelity DNA polymerase (New England BioLabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was amplified via polymerase chain reaction (PCR) using the proof reading Phusion® high fidelity (HF) polymerase (Phusion) (New England Biolabs). Reactions were heated to 98 0C for 30 s ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Synthetic Biology 2021Quote: minD,minE and FtsA genes were amplified by standard polymerase chain reaction (PCR) amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs, USA) as previously reported24,30 ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: sgDNA template was generated using gene-specific oligonucleotides and constant oligonucleotide by polymerase chain reaction for 30 cycles using Q5 high fidelity polymerase (NEB, USA). PCR product was further purified using Magbio Hiprep PCR cleanup system (Magbiogenomics ...
-
bioRxiv - Immunology 2020Quote: ... according to the manufacturer’s instructions.29 RNA reverse transcription and first strand cDNA synthesis were carried out using chain-specific reverse primers30 with ProtoScript® II First Strand cDNA Synthesis Kit (NEB). The resulting cDNA was used as template for preparing the sequencing library using 5’ multiplex PCR as previously described.31 The PCR products corresponding to the library amplification were purified on BluePippin with size cutoff around 500 bp ...
-
bioRxiv - Biochemistry 2022Quote: The P562del and Exo+THR mutants were generated on the pET23-P2-D12A-THR (Table S1) background through inverse Polymerase Chain Reactions (iPCR) using Q5® High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions in 25 μl reactions with primers p2_thumb_loop_R/DEL1 (Table S2 ...
-
bioRxiv - Microbiology 2023Quote: RNA was used as template to detect and quantify viral genomes by duplex reverse transcriptase (RT) quantitative polymerase chain reaction (RT-qPCR) using a Luna Universal Probe one-step RT-qPCR kit (New England Biolabs, E3006E). SARS-CoV-2-specific RNAs were detected by targeting the ORF1ab gene using the following set of primers and probes ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... coli was performed using DH5-alpha or its commercial derivative NEB 10-Beta (New England Biolabs product number C3019I or C3020). Genomic DNA of BY4741 ...
-
bioRxiv - Microbiology 2019Quote: ... Colonies were selected using a gentamycin marker and blue/white colony screening in a background of dH5-alpha cells (New England Biolabs, UK). The resulting construct was transformed into PA14 and the clone used for assays was verified by Sanger sequencing (University of Sheffield ...
-
bioRxiv - Evolutionary Biology 2020Quote: Purified DNA library (250 ng) was cut with the Hind III and Bam HI restriction enzymes (NEB) for 1h at 37 °C in a reaction mixture containing 1X of the NEB cut smart buffer ...
-
bioRxiv - Genomics 2020Quote: ... We put the mutagenized genes in a pIVEX vector via Gibson assembly (NEB Hi-Fi DNA assembly) using 125ng of gene DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and C-terminal additions) were assembled with the pcDNA5 backbone using Hi-Fi DNA assembly (NEB; E2621S).
-
bioRxiv - Plant Biology 2022Quote: ... His-TAD1 fusion proteins were purified according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA, USA). The bait protein GST-WL1 was incubated with GST beads (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).