Labshake search
Citations for New England Biolabs :
101 - 150 of 3577 citations for Collagen Alpha 1 XVIII Chain Endostatin Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... were assembled using Hi-Fi DNA Assembly Mix (NEB). For the SFFV-Cas9 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Genomics 2021Quote: ... was then inserted by Hi-Fi assembly (NEB, E2621) using 0.025 pmols of vector and 0.05 pmols of the GFP amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEB Hi-Fi assembly mix (New England Biolabs). A mixture of the two guide plasmids (each at 100ng/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... We expressed the His-SUGCT in Lemo cells (NEB), inoculating 4L of TB with 4 mL overnight culture ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids were then transformed into DH5-alpha high-efficiency competent cells (NEB). Following transformation ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... MBP (mouse, 1:30,000, New England Biolabs), FLAG (mouse ...
-
bioRxiv - Microbiology 2019Quote: ... or Bam HI and Xho I (New England BioLabs, MA). The column isolated DNA fragments were ligated into our modified pFastBac1 plasmid having 6xHis tag at C-terminus ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB). The resulting next-generation sequencing libraries were sequenced on a HiSeq2500 (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Followed by subcloning the PCR amplicon in Bam-HI (NEB) restriction digested pCW57-tGFP-2A-MCS plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEBuilder Hi-Fi Assembly (New England Biolabs, Cat. #E2621). The pMB1052 construct was subsequently cut using BspDI and EcoRV (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... The Hi-Scribe T7 High Yield RNA synthesis kit (NEB) was used to generate RNA transcripts at 37°C for 16 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... using the NEBuilder Hi-Fi Assembly kit (New England Biolabs). To ensure representation of all variants in the population ...
-
bioRxiv - Cancer Biology 2023Quote: ... cut with hi-fidelity EcoRI and BamHI (New England Biolabs), and gel purified ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... The HIS-SUMO-BAHEPR-1 fusion and HIS-SUMO tag constructs were expressed in Escherichia coli BL21 DE3 cells (New England BioLabs). Both HIS-SUMO-BAHEPR-1 and HIS-SUMO cultures were initially grown in 4 liters of LB media at 37 °C at 200 RPM until cultures reached an optical density of ∼ 1.0 at 600 nm and then cultures were pelleted ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... The donor sequence was generated by subcloning 596 bp upstream of the hrpk-1 stop codon and 600 bp downstream of hrpk-1 stop codon into the pDD282 vector [45] using Hi Fi assembly kit (NEB). The hrpk-1 stop codon was eliminated from the donor sequence to allow in frame GFP tag addition ...
-
bioRxiv - Cell Biology 2021Quote: ... and ligated to linearized vector pGex-6p-1 (GST) or pET28-SUMO (His) also cut with the same restriction enzymes using T4 DNA ligase (NEB).
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Immunology 2019Quote: ... PCR product was cloned into 5-alpha competent bacteria (New England Biolabs, cat. #C2987) using a TOPO TA cloning kit (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2022Quote: Escherichia coli DNA adenine methyltransferase (dam)+/dcm+ (NEB 5-alpha competent E. coli, #C2987) and dam−/dcm− (dam−/dcm− competent E ...
-
bioRxiv - Microbiology 2021Quote: ... coli transformations were performed using NEB 5-alpha chemically competent cells (New England BioLabs). E ...
-
bioRxiv - Biochemistry 2022Quote: ... aliquots of S proteins were digested respectively using alpha lytic protease (New England BioLabs), chymotrypsin (Athens Research and Technology) ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Genomics 2024Quote: ... Ligation products were transformed into either 5-alpha or 10-beta electrocompetent cells (NEB) and grown in liquid LB-Amp cultures ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Microbiology 2019Quote: ... Polymerase Chain Reaction (PCR) was conducted following standard conditions outlined by New England Biolabs (NEB) (Ipswich ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Immunology 2020Quote: Heavy and light chain vectors were verified by sequencing and transformed into DH5alpha cells (NEB). The transformed cells were grown and the plasmid was purified by midiprep (Macherey-Nagel) ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...