Labshake search
Citations for New England Biolabs :
101 - 150 of 917 citations for Coiled Coil Domain Containing 28B CCDC28B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 20 U/μL Exonuclease I (NEB, Cat #M0293), 20 U/μL HinfI enzyme (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 20 μL reaction containing 1X VCE buffer (NEB), 10 μL of the eluted RNA ...
-
bioRxiv - Bioengineering 2020Quote: ... containing 12.4 U/uL RNase If (New England Biolabs) and 0.025 U/uL DNase I (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Effective sgRNA containing constructs were selected by T7E1 (NEB) cleavage assay following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1.5 μl of NEBuffer r2.1 (New England Biolabs). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 0.4 U/ml RNAse inhibitor (New England Biolabs) and were immediately transported to the sequencing facility on ice for further processing.
-
bioRxiv - Biochemistry 2023Quote: ... in 15μl reaction volumes containing the Cutsmart buffer (NEB) or a reconstituted equivalent (50mM Potassium acetate ...
-
bioRxiv - Genomics 2023Quote: ... containing 9U of T4 DNA polymerase (NEB, Cat#M0203S) and 40μM dATG/dGTP and incubated at 20℃ for 4 hours to remove unligated fragments ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 6,25µl of LongAmp Taq 2✕ Master Mix (NEB), 4,25µl of milliQ water ...
-
bioRxiv - Biophysics 2020Quote: ... containing 0.2 mM ATP (New England Biolabs Inc., Ipswitch, MA) as well as 1.0 mM DTT (Carl Roth ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... SDS 0.5%) containing 0.5 μL Proteinase K (20mg/ml, NEB) at 50°C for 2hr ...
-
bioRxiv - Developmental Biology 2020Quote: ... a mix containing 2 μl of RNAse H (NEB, #M0297S), 1 μl of E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dUTP containing strand was degraded with USER enzyme (NEB) and beads were re suspended after washing in 20μl 10mM Tris-HCl pH8 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.5 μg RNA probe containing T7 RNA polymerase (NEB) transcribed NFIB 3’ UTR HP RNA or AR RNA / NFIB 3’ UTR RNA hybrid RNA as control ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 100 μg/mL RNase A (New England Biolabs, USA) for 15 min at 37°C and away from light ...
-
bioRxiv - Genetics 2021Quote: ... PCR reactions (50 µl) containing 1 × Q5 reaction buffer (NEB), 200 µM dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% NP-40) containing 2 μl RNase Inhibitor (M0314, NEB) and 10 μl m6A antibody (ab151230 ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: Twenty microliter reactions containing 10U Exonuclease VIII truncated (NEB, USA) were set up according to the manufacturer’s instructions and incubated at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzyme) in the reaction buffer containing 1 × Cutsmart buffer (NEB), 2 mM ATP (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... pSNAPf vector containing SNAP-tag was purchased from NEB (N9183S) and optimised to Drosophila codon suing Genewiz (USA ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyA containing RNA was then fragmented with fragmentation buffer (NEB)and first strand cDNA was synthesized using random hexamers and M-MuLV Reverse Transcriptase (RNase H-) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 nl of a solution containing 10µM EnGen Cas9 NLS (NEB) and 100 ng/µl of gRNAs was injected at the one-cell stage ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37°C and cDNAs were amplified with KAPA HiFi Hotstart Ready Mix (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS) containing 400 μg/mL Proteinase K (New England Biolabs) and incubated at 65 °C for 1 hr with rotation at 300 RPM ...
-
bioRxiv - Cell Biology 2019Quote: ... reaction buffer containing 1 μL (400 units) lambda phosphatase (P0753S, NEB), reaction buffer containing 1 μL lambda phosphatase plus 1×phosphatase inhibitors cocktail (Roche ...
-
bioRxiv - Genetics 2019Quote: ... each containing 25 µl 2x LongAmp Taq Master Mix (M0287, NEB), 3 µl cDNA PRM primer (cPRM ...
-
bioRxiv - Microbiology 2021Quote: ... in 20μL of reaction mixture containing 1x NEB3 buffer (NEB, USA) and 1u/μL RNasin RNase Inhibitor (Promega ...
-
bioRxiv - Immunology 2021Quote: ... a mix containing 2 μl of RNAse H (NEB, Cat. #M0297S), 1 μl of E ...
-
bioRxiv - Biochemistry 2021Quote: A reaction master mix containing 1X T4 DNA Ligase Buffer (NEB) (2.5 μl/sample volume of 10X T4 DNA Ligase Buffer) ...
-
bioRxiv - Neuroscience 2021Quote: ... Digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) was applied to gels and allowed to digest for 2-16 hours (see Results ...
-
bioRxiv - Neuroscience 2020Quote: ... and sorted directly into lysis buffer containing RNAse inhibitor (NEB E6420). cDNA libraries were made from RNA using NEB’s Next Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB E6420) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37℃ and were finally washed once with 0.1x SSC buffer.
-
bioRxiv - Plant Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 3 hours at 37 °C and were finally washed once with 0.1x SSC buffer ...
-
bioRxiv - Genetics 2021Quote: ... We injected worms with an injection mix containing Cas9 EnGen (NEB), 4 sgRNAs against mir-1 (AAGAAGTATGTAGAACGGGG ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 150ul of 10X NEB T4 DNA ligase buffer (NEB, B0202), 125ul of 10% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Immunology 2020Quote: ... 0.09% Tween-20) containing 0.2 mg/ml protease K (NEB, P8107S) and incubating at 56°C for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20µL of digestion mix containing 125U HinfI (New England BioLabs, #R0155M) and 25U RsaI (New England BioLabs ...
-
bioRxiv - Neuroscience 2021Quote: Samples containing Nluc-GPC4 were treated with Heparinase II (NEB P0735S) and Heparinase III (NEB P0737S ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Cell Biology 2023Quote: ... A mixture containing 600 ng/uL of Cas9 protein (NEB: M0386) and sgRNA complex at a 1:1 ratio was generated with a total volume of 3 uL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein-containing fractions were pooled and incubated with Chitin Resin (NEB) for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...