Labshake search
Citations for New England Biolabs :
501 - 550 of 917 citations for Coiled Coil Domain Containing 28B CCDC28B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... each plug was incubated in 160 μl of 1x NEBuffer 3.1 containing 1 unit/μl of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific mutations in human PSEN1 were obtained by Q5 site-directed mutagenesis of the pMSCV-puro vector containing wild type human PSEN1.26 We designed primers for Q5 site-directed mutagenesis (New England Biolabs) with NEBaseChanger.neb.com and performed site-directed mutagenesis according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× NEBuffer 3.1 buffer containing 160 units of Bgl II (New England Biolabs) overnight at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µl of the annealed oligos were phosphorylated in a 10 µl reaction containing 0.25 µl T4 PNK (10000 units/ml, NEB) and 1 µl 10x T4 ligase buffer for 40 min at 37°Ϲ before heat-inactivation at 65°Ϲ for 20 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... a mix containing 18µM sgRNA and 12µM Cas9 protein (EnGen™ Spy Cas9-NLS S. pyogenes, NEB Cat# M0646T) was incubated for 10 min at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Developmental Biology 2019Quote: ... incubated overnight with anti-SNAP antibody (NEB, Ipswich, MA), washed and probed with goat-anti-rabbit horseradish peroxidase secondary antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... and probed with p62 antibody (NEB D5L7G, 1:800) and streptavidin-594 (Biolegend 405240 ...
-
bioRxiv - Neuroscience 2023Quote: ... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then diluted 1:10 with nuclease free water prior to adding 1 µL to a PCR reaction containing 500 uM forward and reverse primer and 1X Q5 Master Mix (NEB). Reactions were cycled 35 times with annealing temperatures calculated by NEB Tm calculator prior to loading on 2% agarose gels ...
-
bioRxiv - Genetics 2021Quote: ... derived from pEAA238-PMS1) containing FRB or FKBP insertions were constructed using HiFi Gibson cloning (New England Biolabs, Ipswich, MA), with PCR fragments generated from pEAA213 or pEAA238 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 300 μM of complementary primers containing 20 bp overlap - target sequence - and 4 bp of homology to the expression vector were hybridized in a reaction containing 10 μL of 10x T4-ligase buffer (New England Biolabs). The mixture was submitted to 70 decreasing cycles of a minute each - touchdown - from 95 to 25°C and then connected to the previously linearized vector through a reaction containing 15 ng of the previous hybridization ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Supplementary Data 1) P1 adapters (200 nM) containing unique 12 bp barcodes were ligated by incubation with T4 ligase (NEB) at room temperature for 30 min and the reaction was terminated by 20 min at 65°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... this region was amplified using 10 separate pools of 33 nt primers containing NNN in the middle of the primer and using Gibson Assembly Master Mix (NEB) was cloned into pNL4-3 rev-in-nef after digesting by BamHI and XhoI ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... then overnight at 25°C with another 100 μl of the same buffer containing 2.7 μl END-seq adaptor 1 and 1 μl high concentration T4 DNA Ligase (NEB M0202M). After rinsing twice with 1 ml tris buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... were separately subjected to restriction enzyme double digestion at 37 °C overnight in 20 μL volumes containing 20 U BamHI-HF (cat. no. R3136S, New England BioLabs), 20 U EcoRI-HF (cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... a DNA fragment containing TDP-43 was inserted into pCold I-GstTev-HA by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... In-house adapters containing 8-nucleotide unique molecular identifier (UMI) sequences were ligated onto the DNA fragments with T4 DNA ligase (NEB). Excess adapters were removed by AMPure XP beads (Agencourt ...
-
bioRxiv - Genomics 2019Quote: ... We quantified DNA using a Qubit dsDNA BR assay and performed a debranching treatment on 8-10 µg of DNA in 100 µL reactions containing 50 Units of endonuclease T7E1 (New England Biolabs) in 1X NEB buffer 2 ...
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was then dried completely and resuspended in a mixture containing 50 mM ammonium bicarbonate and PNGase F (New England Biolabs) using only H2O18 (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2019Quote: ... By mixing the linearized pCRISPR-BEST plasmid and chemically synthesized spacer containing oligo with the NEBuilder (New England Biolabs, USA). The linearized pCRISPR-BEST plasmid then will be bridged by the spacer containing oligo ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was carried out by PCR amplification of the starting plasmid with forward and reverse mutagenesis primers containing the desired mutation (Table 1) followed by DpnI (NEB) treatment ...
-
bioRxiv - Developmental Biology 2019Quote: ... Repair templates were generated by inserting 500 bp homology arm PCR products into destination vectors containing egfp and a self-excising selection cassette using Gibson assembly (New England Biolabs) or SapTrap assembly (Dickinson et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... Both 3' and 5' ligations were carried out with degenerate adaptors (each containing 4 random nucleotides) in the presence of 10% Polyethylene Glycol (PEG 8000, NEB) and 0.5 μL of Superasin (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 1 µL was used as the template in a PCR amplification containing 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S), 1x Q5 polymerase reaction buffer (NEB ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Genomics 2019Quote: ... we eluted the RNA by adding 4 µl of master mix containing 1 µl of 10 mM dNTPs (New England Biolabs), 0.1 µl of 100 µM 3’ SMART reverse transcriptase (RT ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification was performed in a total volume of 25 µl containing 12.5 µl of 2x OneTaq Mastermix (New England Biolabs, NEB), 9.9 µl of nuclease-free H2O ...
-
bioRxiv - Microbiology 2019Quote: ... Alexa fluor phalloidin 647 was used to stain the actin cytoskeleton and cell nuclei were stained with ProLong Gold Antifade mountant containing 4,6-diamidino-2-phenylindole (DAPI) (New England Biolabs, UK). To determine mucus production ...
-
bioRxiv - Microbiology 2019Quote: ... Second-strand cDNA was synthesized in a reaction mixture containing Second-Strand Synthesis Kit (New England Biolabs; Ipswich, MA, USA). cDNA was purified using the Qiagen purification kit ...
-
bioRxiv - Physiology 2020Quote: ... and the Esp3I fragment of the pPVxRF3 vector (a gift from S. Kondo) containing Venus and 3xP3-dsRed-Express2 using NEBuilder HiFi DNA Assembly Master Mix (NEB). The combined fragment was cloned into pBluescript ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR reaction volumes were set up to 12.5 μL containing Luna Universal qPCR Master Mix (New England Biolabs Inc.), 2 μl of a 1:10 dilution of cDNA reaction ...
-
bioRxiv - Genetics 2020Quote: ... Oligo pairs were mixed at an equimolar ratio in PCR tubes containing T4 Ligation buffer and T4 polynucleotide kinase (NEB) for 5’ phosphorylation of oligos ...
-
bioRxiv - Genomics 2021Quote: ... Methylation reactions were performed in a 100uL reaction containing 1X CutSmart Buffer and 1mM S-adenosyl-methionine (SAM, New England Biolabs) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Plant Biology 2020Quote: ... the genomic regions containing pre-miR775a and the GALT9 coding region were PCR amplified using the Pfusion DNA polymerase (New England Biolabs) and primers listed in Supplemental Table 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... genomic PCR products containing the target sites of selected gRNAs were incubated with SpCas9 protein (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol and analyzed on 2% agarose gel stained with ethidium bromide ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Neuroscience 2020Quote: ... and Genomic DNA was isolated and subjected to PCR to amplify the 433 bp fragment containing gRNA target sequence using Q5 High Fidelity DNA polymerase (NEB) and primers (GAATTC(EcoRI)/GAGTTCTAGTGTCAGAAGAAAAAAGATGAATTTTATTCC and GGATCC(BamHI)/AGCTTTAATAGTGTGCAGGGTCAGTCAG) ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... After bead purification half of the DNA elute was used for a 50-µl PCR reaction containing the NEBNext High-Fidelity 2x Master Mix (NEB), 25 pmol ...