Labshake search
Citations for New England Biolabs :
301 - 350 of 1847 citations for 7 Oxa 12 thia spiro 5.6 dodecan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μl ThermoPol Buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of 3 μL DNase I (NEB), 3 μL 10xDNase I Buffer (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Pathology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were used on cDNA (OneTaq One-Step RT-PCR, New England Biolabs) to evaluate aberrant transcript splicing via gel electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single step PCR was performed using a One-Taq™ PCR reaction kit (NEB, USA) with 30 amplification cycles and 2 ng of original circular-DNA extract as the DNA template ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, #E3005L or #E3006E) according to manufacturer’s instructions and then analyzed with QuantStudio Design & Analysis Software v1.5.1 (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: The purified aptamer pool was then amplified by PCR with One Taq DNA polymerase (NEB), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB) and two 21-base primers (HTOP and HBOT ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were run using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a CFX384 (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... We used the Luna Universal One-step RT-qPCR kit (E3005S, New England Biolabs, MA) to determine the relative abundance of target mRNA between two samples ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was injected into one-cell state embryos together with Cas9 protein (New England Biolabs). Mutant animals were identified by PCR using the primers ...
-
bioRxiv - Immunology 2021Quote: ... and 60 ng were used for the One Taq RT PCR Kit (New England Biolabs) according to the instructions provided by the manufacturer for mRNA quantification and reverse transcription (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB, Cat. # E3005E) following manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: One microliter of cDNA was amplified by PCR using OneTaq DNA Polymerase (New England Biolabs) with with the following primers for the two putative SIFamide receptor ...
-
bioRxiv - Genetics 2020Quote: ... One aliquot of the digested DNA was subjected to overnight RNase H (NEB cat#M0297) treatment at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... using Luna Universal Probe One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and 16s rRNA transcripts by the Luna Universal One-Step RT-qPCR kit (NEB, E3005), according to the manufacturer’s instructions on an Applied Biosystems 7500 Fast Real-Time PCR System ...
-
bioRxiv - Neuroscience 2022Quote: ... The RT-qPCR was performed using Luna One Step RT-qPCR mix with dUDG (NEB). Amplification using Luna One Step qPCR mix with UDG (NEB ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: One hundred nanograms of the amplicon was incubated with 10U of TelN Protelomerase (NEB, USA) according to the manufacturer’s instructions at 30°C for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using a Luna ® Universal One-Step RT-qPCR kit (NEB) in a CFX96 qPCR thermocycler (BioRad) ...
-
bioRxiv - Biochemistry 2023Quote: ... For assessment of HAC1spliced mRNA the Luna Universal Probe One-Step RT-qPCR Kit (NEB) was used with 2 µl of a 50 ng/ µl RNA sample ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (E3005S, NEB). 20μl reactions using 200nM primers and <100ng RNA were run on ABI StepOnePlus Real Time PCR system following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were run using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a CFX384 (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA, USA) and a BIORAD CFX Opus 384 system ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of one plasmid was digested overnight with 10 units PacI (New England Biolabs) in 20 μL at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... and first strand cDNA was synthesized with One-Taq RT-PCR kit (New England Biolabs), according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... The first one made use of Q5 mutagenesis following the manufacturer’s instructions (New England Biolabs), but due to the high GC-content of exon1 specific for the ZNRF3 long isoform ...
-
bioRxiv - Genomics 2024Quote: ... a SYBR green I based qRT-PCR kit (Luna Universal One-Step NEB, Ipswich, USA) was used in PCR mixtures (20 µl ...
-
bioRxiv - Microbiology 2024Quote: ... template genomic DNA was prepared by picking one colony into 50 μL ThermoPol buffer (NEB) with 0.5 μL thermolabile Proteinase K (NEB) ...
-
bioRxiv - Evolutionary Biology 2020Quote: Phage display experiments were performed using the PhD-12 peptide phage display kit (NEB). All steps involving the pipetting of phage-containing samples was done using filter tips (Rainin) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Highly purified commercial preparations for the WT T7RNAP (NEB, 12 U/ul final concentration) and T7-68 (Codexis/Alphazyme Codex® HiCap RNA polymerase ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabsⓇ Inc., MA, USA) was preferred in order to select aggregation inhibitory peptide selection ...