Labshake search
Citations for New England Biolabs :
101 - 150 of 1847 citations for 7 Oxa 12 thia spiro 5.6 dodecan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... One part of RNA was treated with T4 PNK (NEB) in a reaction buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... One half was treated with Lambda phosphatase and MnCl2 (NEB), the other half was treated with MnCl2 only ...
-
bioRxiv - Genetics 2023Quote: ... The Luna Universal Probe One-Step RT-qPCR kit (NEB) following the manufacturer’s protocol was used for the quantification of IBV derived RNA using IBV specific primers (forward 5′-GCTTTTGAGCCTAGCGTT-3′ and reverse 5′-GCCATGTTGTCACTGTCTATTG-3′ ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB), and then analyzed with QuantStudio Design & Analysis Software v.1.5.1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was mixed with Reaction Mix 1 (9:1 of 12 uM NEB RT random 6N-S to 12 uM oligo-dT(20), 12uM dNTPs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and PCR amplified (8-12 cycles) with Phusion polymerase (NEB) using custom primers (22) ...
-
bioRxiv - Genetics 2019Quote: ... and eluted with 12 ul of 1x Cutsmart buffer (NEB). For wild mushroom samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Molecular Biology 2019Quote: ... with Luna Universal One-Step RT-qPCR reagents (New England Biolabs). 50 ng total RNA and 250 nM primers were added in each reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and one round of rRNA depletion (NEBNext rRNA depletion kit, NEB). After ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2019Quote: ... One mm slices of the Midrange PFG markers (NEB cat. N0342S) were placed into the flanking lanes as size standards ...
-
bioRxiv - Microbiology 2021Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs) was used ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... one set of the replicates were treated with lambda phosphatase (NEB) overnight at 25°C before incubation with the pS1615 antibody (Figure 2 – figure supplement 1B).
-
bioRxiv - Genetics 2022Quote: ... we used the Luna One Step RT-qPCR kit from NEB according to the manufacturer’s instructions at 10μl total volume in 384 well plates ...
-
bioRxiv - Genetics 2022Quote: ... One 20 μl ligation reaction using T4 ligase (New England Biolabs) was carried out using 0.9 ng of the gel-purified insert and 500 ng of the vector ...
-
bioRxiv - Systems Biology 2019Quote: ... and the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Primer sequences used are described in Table S2 ...
-
bioRxiv - Cell Biology 2020Quote: Centrosomal circularities were evaluated in one-cell embryos ranging from NEB to metaphase that were immunostained with an antibody against SPD-5 ...
-
bioRxiv - Biochemistry 2022Quote: ... by Luna Universal One-Step RT-qPCR Kit (New England BioLabs) according to the manufacturer protocol ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μl 2X Luna Universal One-step Reaction mix (NEB). Samples were measured in triplicates ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal one-step qRT-PCR kit (New England BioLabs) as previously described (13 ...
-
bioRxiv - Systems Biology 2023Quote: ... using the Luna Universal One-Step RT-qPCR Kit (NEB, #E3005). No template and genomic DNA controls were included in all experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, Massachusetts) was used to quantify the RNA samples per the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs) was used for the detection of viral genomes in the heat-inactivated samples performed through reverse transcription quantitative polymerase chain reaction (RT-qPCR) ...
-
bioRxiv - Genetics 2024Quote: ... One microliter of oligo d(T)23VN primer (50 μM) (NEB) was added to 200 ng/µL of RNA (170 ng worm RNA + 35 ng yeast RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were transferred to 7 ml of 1.15x T4 ligation buffer (NEB), incubated with 1% Triton X-100 for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at −20 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 µl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3□μf USER Enzyme (NEB) was then used with the size-selected ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl HinP1I (NEB R0124S), 3 μl DdeI (NEB R0175L) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl CviAII (NEB R0640L), 3 μl FspBI (ThermoFisher ER1762) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl DdeI (NEB R0175L), 3 μl CviAII (NEB R0640L) ...