Labshake search
Citations for New England Biolabs :
301 - 350 of 3513 citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 pmoles of ssDNA were phosphorylated with 0.7 µl of [γ-32P]-ATP (7 µCi, Hartman Analytic) using T4 polynucleotide kinase (10 U, NEB). The reaction was supplemented with 10 mM DTT and incubated for 30 min at 37°C ...
-
bioRxiv - Systems Biology 2020Quote: ... One microgram of purified RNA was fragmented at 95 °C for 7 min in 1X T4 RNA Ligase buffer (NEB) with an equal volume of 2X alkaline fragmentation buffer (0.6 volumes of 100 mM Na2CO3 plus 4.4 volumes of 100 mM NaHCO3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Luciferase activity was determined in a luminometer (Optocomp I) by the addition of ∼18 µl of sample to 6-7 µl diluted coelenterazine (for Gluc, NEB), or ∼20 µl of sample to 15-18 µl Fluc substrate (Promega).
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR-amplified using primers listed in Supplementary Table 7 and cloned into the px601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB). Similarly ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Biochemistry 2022Quote: AP-DNA was prepared by incubating 50 μM 7-mer ssDNA [d(GTCUGGA]] with 10 U of uracil DNA glycosylase (UDG, New England Biolabs) in UDG Buffer at 37 °C for 1.5 h ...
-
bioRxiv - Genomics 2022Quote: ... The long RNAs were then fragmented to 70-100 nt by using an NEBNext Magnesium RNA Fragmentation Module (94 °C for 7 min; New England Biolabs). After clean-up by using a Zymo RNA Clean & Concentrator kit (8X ethanol protocol) ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the M8 amplicon were also performed similarly except Q5TM polymerase (5.3×10-7 approximate error/bp; New England BioLabs, USA) was utilized ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
On the causes, consequences, and avoidance of PCR duplicates: towards a theory of library complexitybioRxiv - Molecular Biology 2022Quote: ... Custom P1 adapters containing a 7-bp unique barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample using a T4 ligase (NEB). The 150 robin samples were pooled at equimolar concentrations ...
-
bioRxiv - Molecular Biology 2022Quote: ... A total of 50 unit of T4 DNA ligase along with 7 μl of 20 ng/μl of BSA (Biolabs) and 7 μl of 100 mM ATP were added to reach a final volume of 700μl ...
-
bioRxiv - Genetics 2023Quote: ... We next linearized pattB-DSCP-QF#7-hsp70 (Plasmid #46133)123 using BamHI and NsiI and with Gibson Assembly (NEB) cloned R49E06 promoter in the plasmid.
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Ligation was performed on a 7-fold dilution of HindIII-digested chromatin using 100 units of Quick T4 DNA ligase (New England Biolabs) at 16°C for 16 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: Assessment of the integration status of the HPV-positive HNSCC cell lines was characterized for each cell line and digested with 7 µg of total genomic DNA at 37°C overnight (20 hours) with either EcoRV (New England BioLabs) or Bam HI ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Custom P1 adapters containing unique 7-bp barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample with T4 ligase (New England Biolabs). The DNA from all uniquely barcoded individuals in a library was pooled at equimolar concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... # P0708S) and the presence of O-linked sugars was assessed by combined treatment with O-glycosidase (NEB #P0733S) and α2-3,6,8 neuraminidase (NEB #P0720S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or O-glycosidase + neuraminidase (New England Biolabs), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...