Labshake search
Citations for New England Biolabs :
101 - 150 of 3513 citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl Taq 5× Master Mix (New England Biolabs) and 18 µl Milli-Q water (18.2 MΩ cm) ...
-
bioRxiv - Developmental Biology 2023Quote: ... then capped with m7G(5’)ppp(5’)G (NEB) and tailed with a poly(A ...
-
bioRxiv - Genomics 2022Quote: ... A restriction digestion mix containing 7 µl of 10X NEB CutSmart Buffer (NEB #B7204), 4.5 µl of NlaIII (NEB #R0125) ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs), and (3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs). Illumina Truseq adapters (Affymetrix ...
-
bioRxiv - Genetics 2021Quote: ... 7 μg of ligated chromatin was digested with 10U specific second cutter NlaIII (R0125S, NEB) in 100 μl system with CutSmart Buffer (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μL of the processing reaction products were treated with 10 units Quick CIP (NEB) in 1X CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... Mutant segment 7 plasmids were generated through Q5 Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with 2.5 ng/μl pCFJ90(Pmyo-2::mCherry) and 77.5 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate two independent strains expressing Ex[Pcol-10::mCherry::his-58::SL2::drl-1 cDNA] (DLS515 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cell Biology 2020Quote: ... and O-glycosidase (NEB). Sperm cells were washed with 1x reaction buffer for each enzyme by centrifugation at 800 x g for 3 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Genomics 2019Quote: ... 7 µL of eluate were treated with 0.5 µL exonuclease I (E. coli, New England Biolabs) in 1 x Herculase II reaction buffer (1 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...