Labshake search
Citations for New England Biolabs :
401 - 450 of 7279 citations for 7 CHLORO N N DIETHYL 4 NITRO 2 1 3 BENZOXADIAZOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The remaining part of Luc2-ZsGreen (BEI cat# NR-52516) and the amplified N gene were ligated via Gibson assembly (NEB cat# E2611). The coding sequences of generated plasmids were sequence-verified.
-
bioRxiv - Molecular Biology 2023Quote: ... This sequence was inserted into a modified pST50 vector56 containing N-terminal Strep-6xHis-TEV-GFP-PreScission tags using Gibson assembly (NEB Cat #: E2611L) to obtain a tagged construct of full-length HURP ...
-
bioRxiv - Genomics 2021Quote: ... and 4 μl 5 U/μL I-SceI (NEB, #R0694L) in a 50 μL final volume for 3 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... column-purified and transformed in 4 or 5 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Microbiology 2019Quote: ... 20 μg of total RNA were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) through a 16 h incubation at 16°C with 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Microbiology 2020Quote: ... 3-5 μg of RNAse H treated RNA was circularized using T4 RNA ligase 1 (ssRNA Ligase, New England Biolabs), RNA was extracted with phenol/chloroform approach and ethanol precipitated ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of NEB Buffer 2 (New England Biolabs), 2 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Genomics 2020Quote: ... DNA was sheared to ∼550 bp fragments using a Covaris S220 sonicator and end-repaired by incubating the samples with T4 DNA Polymerase (New England Biolabs, Cat. N: M0203) for 4h at 20°C ...
-
bioRxiv - Microbiology 2019Quote: ... asparagine 36 and 484 were replaced by glutamine in N-glycosylation sites through PCR using the Gibson Assembly® Cloning Kit (New England BioLabs, Frankfurt, Germany) with primers PDI1Asn36mut-1 and PDI1Asn36mut-2 for the mutation N36Q and primers PDI1Asn484mut-1 and PDI1Asn484mut-2 for the mutation N484Q ...
-
bioRxiv - Cell Biology 2019Quote: ... PACRGΔ1-69 was amplified from the GST-PACRGFL plasmid with PCR primers introduced BamHI (N-terminal) and XhoI (C-terminal) restriction sites for ligation in pGEX-6p1 with the T4 DNA ligase (NEB; Suppl. Figure S9). To generate the PACRG:MEIG1 co-expression vector the same protocol was performed as above using restriction enzyme cloning ...
-
bioRxiv - Immunology 2021Quote: ... and converted to cDNA with ProtoScript® II First Strand cDNA Synthesis Kit (cat. n° E6560L, NEB, New England Biolabs, Ipswich, MA, USA) according to manufacturing specifications ...
-
bioRxiv - Immunology 2021Quote: ... and converted to cDNA with ProtoScript® II First Strand cDNA Synthesis Kit (cat. n° E6560L, NEB, New England Biolabs, Ipswich, MA, USA) according to manufacturing specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... The synthetic genes encoding WT human TRIM28 with an N-terminal maltose binding protein (MBP) affinity tag (UniProt: Q13263) were subcloned to the pMAL-p2X vector (New England Biolabs, Beverly, MA, USA).
-
bioRxiv - Biochemistry 2024Quote: N-term-His-ELMO1C438A construct was generated from N-term-His-ELMO1 construct obtained above using Q5® Site-Directed Mutagenesis Kit (New England BioLabs, cat # E0554S), with the following primers.
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Systems Biology 2023Quote: ... The second strand was synthesized using Klenow Fragment (3’ → 5’ exo-) (NEB). The dsDNA library was digested with Mlul-HF and Pad restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and for A-tailing with Klenow Fragment (3’->5’ exo–) (NEB; M0212). A biotinylated primer (ENDseq-adaptor-1 ...
-
bioRxiv - Genomics 2023Quote: ... 10 μL of Digestion-3 mix (5 U NotI-HF (NEB, R3189L) in 1X CutSmart buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Digested DNA was treated with Klenow Fragment (3’→5’ exo-) (NEB, M0212) in a final volume of 250 µL of 1x NEBNext dA-tailing reaction buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4-5 cycles of PCR with OneTaq polymerase (New England Biolabs) was performed using the forward (pBPS_fwr ...