Labshake search
Citations for New England Biolabs :
651 - 700 of 7279 citations for 7 CHLORO N N DIETHYL 4 NITRO 2 1 3 BENZOXADIAZOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... A single adenine base was added to fragment ends by Klenow fragment (3′ to 5′ exo minus; NEB), followed by ligation of Illumina adaptors (Quick ligase ...
-
bioRxiv - Microbiology 2019Quote: ... Primer sequences were as previously described.7 Samples were digested with 1 unit of BamHI-HF enzyme (NEB) prior to running the PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2019Quote: 2–3 μL of recovered DNA was electroporated into NEB® 10-beta Electrocompetent cells (C320K, NEB) and plated on chloramphenicol LB plates ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Nuclei were pelleted at 500 × g at 4°C for 5 minutes and resuspended in 0.5 mL of 1.2x NEBuffer r2.1 (New England Biolabs) containing 3% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl 10x NEBuffer 1 (New England Biolabs), 2 μl 50 mM MnCl2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ end of the first block and the 3’ end of the last block contained SapI (NEB, R0569) recognition sites instead ...
-
bioRxiv - Molecular Biology 2020Quote: ... Selectively captured polyadenylated RNAs (1μg) were ligated directly to an DNA/RNA hybrid adapter (5’-CTACAC GACGCTrCrUrUrCrCrGrArUrCrUrNrNrN-3’) using T4 RNA ligase (NEB) at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Biochemistry 2021Quote: ... Construct included 5’ and 3’ complementary overhangs for ligation into pPICZαA using NEBuilder HiFi DNA Assembly (New England Biolabs) to form pPICZαA_GH43_34 ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were incubated for 5 min on ice and 3 μL of 10X G5 buffer (New England BioLabs, UK) were added to the samples together with 1.5 μL of 25X concentrated protease inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the second linker SI183 5’-/Phos/NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/ddC/-3’ was preadenylated by Mth RNA Ligase (New England Biolabs) as described previously8 ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and was cloned into PCW57.1 at the 5’ BSRGI and 3’ BAMHI restriction sites using NEBuilder HIFI DNA Master Mix (New England BioLabs).
-
bioRxiv - Genomics 2023Quote: ... 5 µg of genomic DNA was dephosphorylated by 3 µL of Quick Calf Intestinal Phosphatase (CIP, New England Biolabs) in a total volume of 30 µL for 10 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... the 5’-PPP RNA in the total RNA was specifically capped with 3’-Desthiobiotin-GTP (New England BioLabs, N0761) by the Vaccinia Capping System (New England BioLabs ...
-
bioRxiv - Plant Biology 2024Quote: ... This end-repaired DNA was subjected to A-tailing using the Klenow 3′–5′ exo− enzyme (New England Biolabs). The subsequent step involved the ligation of methylated adapters to the A-tailed DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...