Labshake search
Citations for New England Biolabs :
51 - 100 of 7279 citations for 7 CHLORO N N DIETHYL 4 NITRO 2 1 3 BENZOXADIAZOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein/lysate sample de-N-glycosylation using PNGase F (NEB), Endo S (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The N expression plasmid was linearized using EcoRV-HF (NEB). Capped-RNA was produced using the mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... or peptide N-glycanase (PNGase, New England Biolabs, 1,000 units) for 6 h ...
-
bioRxiv - Microbiology 2022Quote: ... N-glycans were isolated by treatment with PNGase F (NEB) under denaturing conditions followed by solid phase extraction purification ...
-
bioRxiv - Biochemistry 2023Quote: ... the N-glycans were released using peptide:N-glycosidase F (NEB, in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Neuroscience 2020Quote: ... Engineered SiR vectors carrying d.C1349G or d.G1357T PEST-targeting mutations were produced by PCR amplification of the Rabies genome in 2 fragments starting from the end of N assembled using Gibson master mix (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and digested with 200U DpnII (New England Biolabs, Cat. N: R0543) overnight at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... N-glycans were digested using PNGase-F (New England Biolabs, P0704S) essentially according to manufacturer’s protocol but with a three-hour incubation at 37 °C.
-
bioRxiv - Immunology 2021Quote: ... BbvCI (cat. n° R0601L, NEB, New England Biolabs, Ipswich, MA, USA), to obtain the linearized plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... glycerol-free peptidyl-N-glycosidase F (PNGase F) (New England Biolabs), Endoglycosidase Hf (Endo Hf ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...
-
bioRxiv - Immunology 2021Quote: ... BbvCI (cat. n° R0601L, NEB, New England Biolabs, Ipswich, MA, USA), to obtain the linearized plasmid ...
-
bioRxiv - Genetics 2022Quote: ... at the N-terminal by using SalI (New England Biolabs, # R3138S) and NotI (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, #P0704S) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... and m7Gppp5′N cap was added using Vaccinia Capping System (NEB). To induce superovulation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of ProtoScript II reverse transcriptase 200 U / µL (cat. n° M0314L NEB, New England Biolabs, USA), 2 µL of random primer mix 60 µM (cat ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: For analysis of protein N-glycosylation PNGase F (P0704S, New England Biolabs) was used and the assay was performed according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Removal of N-linked glycans and glycosaminoglycans (GAGs) using PNGaseF (NEB #P0704), heparinase II (NEB #P0736) ...
-
bioRxiv - Biochemistry 2021Quote: Peptide-N-glycosidase F (PNGase F) (New England Biolabs Inc., Cat. P0704S) was used for complete removal of N-linked oligosaccharides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α-N-acetyl-galactosaminidase (New England Biolabs, 10 U/μg protein). Removal of sialic acids was performed using the α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: The N-glycans of ACE2 were removed by PNGase F glycosidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Molecular Biology 2021Quote: ... µM GAT-7N primers (5′- GTG AGT GAT GGT TGA GGT AGT GTG GAG NNN NNN N) and 2 units/µl DeepVent® (exo-) DNA polymerase (New England Biolabs, M0259L) in the programmable thermal cycler for 11 cycles ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...