Labshake search
Citations for New England Biolabs :
351 - 400 of 5463 citations for 7 CHLOROMETHYL 2 2 DIMETHYL 2 3 DIHYDRO 1 BENZOFURAN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting PCR amplicons were denatured and re-annealed in 1 × NEB buffer 2 (NEB) in a total volume of 9 μl using a following conditions ...
-
bioRxiv - Genomics 2023Quote: ... 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs), 160 µL of 40 U µL-1 Taq DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 uL of T4 RNA ligase I (NEB M0204S) totaling 20 uL and incubated for 1 hour at 30 C.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10X RtcB reaction buffer (New England Biolabs), 2 μl 1mM GTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by adding 2 μl of RNase A (NEB) and incubating at 37 °C for 45 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1x T4 RNA Ligase 2 reaction buffer (NEB, M0239S), and 0.5 units/µl T4 RNA Ligase 2 (NEB ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of NEB Buffer 2 (New England Biolabs), 2 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 ng of 2-log DNA ladder (NEB N3200) was included for reference ...
-
bioRxiv - Genomics 2020Quote: ... the NEBNext High-Fidelity 2× PCR Master Mix (NEB) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext HiFi 2× PCR Master mix (NEB) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 unit of murine RNase inhibitor (New England Biolabs), varying amounts of target RNA ...
-
bioRxiv - Bioengineering 2021Quote: ... Its constituents were 1X RNA Ligase 2 buffer (NEB) supplemented with 5% PEG 8000 ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by incubation with 2 Units USER enzyme (NEB) for 10 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... packed with 2 ml amylose resin (New England Biolabs) equilibrated with buffer AF ...
-
bioRxiv - Genomics 2022Quote: ... 0.7 µl T4 ligase (2 M U/ml, NEB), 250 ng DNA (adapters in File S1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 units of phi29 DNA polymerase (New England Biolabs), three not to quantified deoxynucleoside triphosphate mix (20 μM) ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μl Phusion DNA polymerase (2 U/μl, NEB), 160 μl Taq DNA ligase (40 U/μl ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of undiluted Thermolabile Proteinase K (NEB #P8111S) and 1 μl SUPERaseIN (20 U/μl ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μl of 10 mM dNTPs (New England Biolabs), 2.5 μl of 10 μM oligonucleotide A (unmodified forward primer ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 µl Deglycosylation Mix Buffer 2 (New England Biolabs) was added to 17 µg of protein a 40 µl total volume ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by incubation with 2 Units USER enzyme (NEB) for 10 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... for 2 hours or ShortCut RNaseIII (New England Biolabs) for 20 minutes at 37°C after permeabilization before blocking.
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5 vol 2×Phusion Master Mix (New England Biolabs), and 0.04 vol P1 and P2 amplification primers (10 nm) ...
-
bioRxiv - Microbiology 2019Quote: ... and ExoI (New England Biolabs, 2 U/µg RNA) for 30 min at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... 2uL 2 000 000U T4 DNA ligase (NEB, M0202). The reaction was incubated at room temperature for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 1X Phusion buffer and 2 U Phusion Polymerase (NEB). The PCR protocol used was an initial denaturation of 30 s at 98 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of 10% NP-40 (NEB Cat # B0701S) and 6 μL of water were mixed with the 10 μL of denatured spike glycoprotein ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl NEBuffer 2 (New England Biolabs, Ipswich, USA); 0.3 μl T7E1 enzyme at 10 Units/μl (New England Biolabs ...