Labshake search
Citations for New England Biolabs :
351 - 400 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... After ligation at RT for 4 h with T4 ligase (NEB), the nuclei were pelleted ...
-
bioRxiv - Genomics 2020Quote: ... with 4 μl (400 U/μl) of T4 DNA ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Bioengineering 2021Quote: ... 2.5 µL of 4 mM dNTPs (New England Biolabs, Ipswich, MA), and SuperScript II RT Enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of T4 DNA polymerase (NEB M0203, 3U/μl), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplied with the enzyme) and 4 units of DNAse I (NEB) were incubated at 37 °C for 60 min ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFD4_Lamp_13 pCFD4_lamp1-30_4-4 were made by Gibson assembly (NEB # E5510S) using oligos Lamp1_crips_61_for ...
-
bioRxiv - Immunology 2022Quote: ... 4 μL LunaScript RT SuperMix 5X (New England Biolabs, NEB, USA) and 8 μL nuclease free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... and α1-3,4 fucosidase (New England Biolabs, 4 U/μg protein). All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 hours at 55°C ...
-
bioRxiv - Pathology 2021Quote: ... 4 μM of each gRNA was combined with Cas9 (NEB #M0646) and Cas9 buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs), and 48 μL water ...
-
bioRxiv - Genomics 2022Quote: ... but instead incubated with 4 units of Dam enzyme (NEB, M0222L) during the activating step ...
-
bioRxiv - Plant Biology 2022Quote: ... Supernatants were treated with 4 µL of DNAse I (NEB, EN0521) and incubated for 10 min at 37°C with shaking at 1,200 rpm ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of 20 mg/mL Proteinase K (New England BioLabs) was added and incubated for 1 h at 55 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 units of BstBI (R0519 New England Biolabs Inc., Ipswich MA) was added ...
-
bioRxiv - Immunology 2023Quote: ... 4 U/μL Exonucluease I (New England Biolabs, cat.: PN MO293L) was added to the preamplification mix and incubated in the thermocycler for 30 min at 37°C and 15 min at 80°C to remove non-incorporated primers.
-
bioRxiv - Systems Biology 2024Quote: ... Samples were then treated with 4 units of DNase I (NEB) for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... followed by a 4-hour linearization with XbaI endonuclease (NEB, Canada) at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μl of 6x Gel Loading Dye (B7025S, New England Biolabs) and 1 μl of 2.5 mg/ml EtBr were added to the RNA size markers.
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...