Labshake search
Citations for New England Biolabs :
501 - 550 of 7667 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... One piece of brain tissue (∼300 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Plant Biology 2022Quote: ... The entry module pGG-B-AtU6-26-BRI1-2-C and pGG-A-AtU6-26-BRI1-3-B were generated by annealing oligos for each gRNA and ligating into BbsI-digested (New England Biolabs) Golden Gate entry vectors described in (66) ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... branched DNA (which can be a consequence of the RCA) was resolved by a 1 hour incubation at 37°C with 4 μl T7 endonuclease (New England Biolabs) and re-purified using AMPure beads ...
-
bioRxiv - Genomics 2019Quote: ... we eluted the RNA by adding 4 µl of master mix containing 1 µl of 10 mM dNTPs (New England Biolabs), 0.1 µl of 100 µM 3’ SMART reverse transcriptase (RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... excess salts and enzymes were removed by centrifugation (600 g for 5 minutes at 4°C) and the cell pellet was re-suspended in 995 μl of 1 x ligation buffer (NEB) supplemented with BSA (100 μg/mL final concentration) ...
-
bioRxiv - Systems Biology 2022Quote: Expression vectors (SCRIPT 1-4; Supplemental Figure S1) were constructed by a Golden Gate reaction with BsaI (New England Biolabs) using the paired gRNA entry vectors and a destination vector as previously described (Decaestecker et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mixed diluted primers (1.7 μl) were combined with 1 μl of annealing buffer (10X NEBuffer 4, New England Biolabs Inc.) on ice in reaction tubes ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Molecular Biology 2023Quote: ... increasing volumes of SPRI beads were mixed with 1 μl of a 4-fold dilution of 100 bp DNA ladder (New England Biolabs) and diluted to a final volume of 100 μl with 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2023Quote: ... was generated by amplifying 1 kb fragments upstream and downstream of the region (Table 4) and cloned into pKNOCK-bla-erm57 using NEBuilder (NEB). The plasmid was conjugally transferred into B ...
-
bioRxiv - Genomics 2023Quote: ... 30 minutes at 72°C and finally held at 4°C until 1 μl Exonuclease I (20U/μl, catalog num. M0293S, NEB) was added to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysates were incubated for 1 hour at 4 °C on a nutator with 40 µL amylose resin slurry (New England Biolabs) equilibrated with amylose wash buffer ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... 19 μL binding mixture containing 4 μL nuclear extracts and 5U Rnase H (NEB) or bovine pancreatic RNase A (Qiagen ...
-
bioRxiv - Zoology 2019Quote: ... 4 µL NEB Deoxynucleotide Solution Mix (10 mM each nt) (New England BioLabs, USA), 1 µL Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Biochemistry 2021Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate GT10 5’_pSY45_pDS66_GT10cHA3 Flox_GT10 3’_pUC19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the supernatant fraction was incubated with 4 ml amylose resin (New England Biolabs, E8021L) for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... then 4 μl of Q5 High-Fidelity 2X Master Mix (NEB, cat. no. M0541L) was added to each well ...
-
bioRxiv - Genomics 2022Quote: ... the DNA was added to 4.5 μL of 10X NEBuffer 4 (New England Biolabs), uridine diphosphate-6-azideglucose (UDP-6-N3-Glu ...
-
bioRxiv - Microbiology 2023Quote: ... gene marker cassette by overnight ligation at 4 °C with T4 DNA Ligase (NEB). Overnight ligations were transformed into chemically competent DH5ɑ E ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs) followed by heat-inactivation for 10 min at 80 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μL template DNA and 0.4 units of Phusion High-Fidelity DNA Polymerase (NEB) (primer sequences provided in Table S3) ...
-
bioRxiv - Genomics 2023Quote: ... and 30% for overnight at 4 °C) with RNase inhibitor [New England Biolabs (NEB), M0314L ...
-
bioRxiv - Genomics 2022Quote: ... 16 µl RNA were mixed with 4 µl LunaScript master mix (NEB cat# E3010L), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Fragmented gDNA (4 μg) was digested with 20 U of RNase H (NEB #M0297S) for 6 hours to serve as a negative control ...
-
bioRxiv - Plant Biology 2023Quote: ... Degalactosylation was done with β1-4 galactosidase following the manufacturer’s instruction (New England Biolabs), and desalted and dried using Sep-Pak C18 cartridge and SpeedVac ...
-
bioRxiv - Developmental Biology 2023Quote: ... ∞ at 4 °C) using NEBNext HighFidelty 2x PCR Master Mix (New England Biolabs, M0541S) and Illumina i5 and i7 indices54 ...
-
bioRxiv - Genomics 2024Quote: ... the DNA was added to 4.5 µL of 10X NEBuffer 4 (New England Biolabs), uridine diphosphate-6-azideglucose (UDP-6-N3-Glu ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 pmol of each used in a 4-fragment Gibson assembly reaction (NEB) to generate TbGT8 5’_BSDr_TbGT8 3’_pUC19 ...
-
bioRxiv - Genetics 2024Quote: ... 120 μL (4 mg/mL) streptavidin magnetic beads (NEB cat no. 50-812-660) were washed 3 times with 1 mL of lysis buffer then resuspended in 100 μL of complete lysis buffer and added to the hybridization mix and then incubated at 37 °C for an additional 30 min with mixing ...
-
bioRxiv - Developmental Biology 2021Quote: ... with subsequent end repair/dA-tailing reaction using Klenow Fragment (3’-5’ exo-) (NEB M0212S) and ligation with Illumina sequencing adapters using T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... The ligation mix (5 μL of LNB, 3 μL of Quick ligase (New England Biolabs), 1.2 μL of MQ ...
-
bioRxiv - Pathology 2021Quote: ... The second strand was synthesized with Klenow Fragments (3′-5′ exo-; New England Biolabs Inc.) and complement chains of NSR primers ...