Labshake search
Citations for New England Biolabs :
101 - 150 of 3330 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... The sheared DNA was used as input for the NEBNext Enzymatic Methyl-seq (NEB E7120) following the manufacturer’s instructions except for doubling the reaction incubation times ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Genomics 2021Quote: ... One-step qRT-PCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) and 5 ng RNA per reaction in technical duplicate with a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... One was to use a kit to generate sequencing libraries in one-tube reactions (NEB, E7103S). Another modification was to spike-in the panel of synthetic nucleosomes carrying major histone methylations (EpiCypher ...
-
bioRxiv - Genomics 2023Quote: ... one female and one male HRFI) were artificially methylated using the M.Sss1 Enzyme (New England BioLabs) following the manufacturer instruction ...
-
bioRxiv - Microbiology 2021Quote: ... One microliter of RNase H (NEB) was added to each tube ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution DNase (NEB) digestions were performed ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed 2 times with EB2 without NaF or PhosStop and one time with λpp buffer (New England Biolabs, Ipswich, MA) before resuspension in 40 μl of λpp buffer ...
-
bioRxiv - Genomics 2021Quote: ... EM-seq libraries from both laboratories were prepared using the NEBNext Enzymatic Methyl-seq (E7120, NEB) kit following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... a sequencing library was prepared using NEBNext® Enzymatic Methyl-seq Kit (NEB; catalog number E7120S). Library sequencing was performed using NextSeq 2000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 200 ng DNA using the NEB Enzymatic Methyl-Seq kit (NEB #E7120) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Microbiology 2019Quote: 2–3 μL of recovered DNA was electroporated into NEB® 10-beta Electrocompetent cells (C320K, NEB) and plated on chloramphenicol LB plates ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 10x T4 ligase buffer, 3 µL 50 mg/mL BSA, 1.5 µL 2000U/µL T4 ligase, NEB, 6 µL BLISS adapter pairs). For removal of excess adapters ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... One microliter of QuickCIP (New England Biolabs) was added and the solution was incubated at 37 °C for 10 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One microliter of T7 endonuclease Ⅰ (NEB) was added to the sample ...
-
bioRxiv - Bioengineering 2022Quote: ... and one with BseYI (NEB cat# R0635S) according to manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then pulse labelled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4 µM final concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... The constructs were subjected to treatment with NEBNext® Enzymatic Methyl-seq (EM-seq™) (NEB, #E7125) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs) were added to improve the efficiency of the reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... SssI enzyme in the presence of 160 µM of the methyl donor S- adenosylmethionine (New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... Enzymatic conversion was performed using the NEBNext Enzymatic Methyl-seq Conversion Module (New England BioLabs, Cat#E7125S) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...