Labshake search
Citations for New England Biolabs :
51 - 100 of 3330 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2019Quote: ... Individual fragments were designed that possessed 5’ and/or 3’ sequence homology to one another using Q5 high-fidelity DNA polymerase (New England Biolabs), followed by stitching the individual fragments together in a SOE reaction.
-
bioRxiv - Plant Biology 2020Quote: ... epicentre cat # ER0720 or ER81050-we used this one) and A-tailing (100mM dATP; bioPioneer inc, Klenow; (3’-5’ exo- NEB) # M0212L (1,000 units ...
-
bioRxiv - Plant Biology 2022Quote: ... Four vectors including one of the active 5′gRNA-pairs and one of the active 3′gRNA-pairs were digested by BglI (New England Biolabs) and ligated at once ...
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Genomics 2020Quote: ... sticky ends were filled by incubating the nuclei for 4h at RT with DNA Polymerase I (New England Biolabs, Cat. N: M0210) and a biotin-14-dATP (Life Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... or enzymatic methylation conversion (Enzymatic Methyl-seq Conversion Module, NEB Product #E7125L) to convert unmethylated cytosine to uracil ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed by using the NEBNext Enzymatic Methyl-seq Kit (NEB), following manufacturer’s guidance ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Total DNA is then converted with NEBNext Enzymatic Methyl-seq Conversion Module (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: DNA was converted using NEBNext Enzymatic Methyl-seq conversion module (New England Biolabs) according to the manufacturer’s instructions ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using the NEBNext® Enzymatic Methyl-seq Kit (NEB, #M7634) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Bioengineering 2019Quote: ... with 3, 6, or 12 nM iSpinach DNA (IDT, USA, Ultramers) template in transcription buffer (1x RNAPol Reaction Buffer (NEB, No ...
-
bioRxiv - Biophysics 2020Quote: ... MBP-GLIC was eluted using 2 column volumes of Buffer B1 with 300 mM imidazole and 0.02% DDM and then applied to an amylose resin column (New England Biolabs). Amylose resin column bound to MBP-GLIC was washed with 2 column volumes of Buffer B1 with 0.02% DDM and MBP-GLIC was eluted using 2 column volumes of Buffer B1 with 20mM maltose and 0.02% DDM ...
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... The samples were converted for sequencing with the NEBNext enzymatic methyl-seq kit (NEB) and sequenced at the University of Minnesota Genomics Center ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Genomics 2021Quote: ... One μL APOBEC3A (NEB #E7120S) was added directly to the reaction with 10 μL of 10x APOBEC3A reaction buffer and 1 μL BSA (10 mg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution (NEB) DNase digestions were performed ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Neuroscience 2021Quote: ... Genes of interest were amplified with the One Taq One-Step RT-PCR kit (NEB) using 1 μg of RNA ...
-
bioRxiv - Microbiology 2021Quote: ... with Luna Universal One-Step Rt-qPCR & Probe One-Step RT-qPCR Kits (NEB, USA), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment of human Plexin-B1 cDNA (encoding amino acids 1-535) was cloned into the pcDNA5 vector using HindIII (R0104S, NEB) and XhoI (R0146S ...
-
bioRxiv - Genetics 2023Quote: ... and incubated with restriction enzyme-digested CD510-B1 plasmid (SystemBio) and assembled with Gibson Assembly Master Mix (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...