Labshake search
Citations for New England Biolabs :
251 - 300 of 3773 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 U of Bst DNA polymerase (large fragment; New England Biolabs Inc., Beverly, MA, USA), 1x of the supplied buffer and a variable amount of DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... then immediately mixed with 8 μL NEBNext Second Strand Synthesis Reaction Buffer (New England Biolabs), 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Truncated ric-8 constructs were generated by PCR using high-fidelity Phusion DNA polymerase (NEB). Phosphorylation mutants were created using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Microbiology 2023Quote: ... For the ligation reaction 8 µL of the digest was treated with T4 Ligase (NEB) for 16 hours at 16 °C ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... mixing with 5 μL of stop buffer (50 mM EDTA and 2 mg/ml Proteinase K (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Biochemistry 2023Quote: ... VCE or FCE::T7RNAP fusion and 5 U/μL vaccinia cap 2′-O-methyltransferase (New England Biolabs). Reactions were carried out at indicated temperatures for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... After CIP inactivation (2 min at 80°C) piRNAs were 5΄end radiolabeled by T4 PNK (NEB) with [γ-32P] ATP (10mCi/mL ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification (8-9 cycles) was performed with 10 μL Fusion HF Buffer (New England Biolabs), 3.125 μL 10uM TruSeq Primer 1 ...
-
bioRxiv - Microbiology 2019Quote: ... and PCR enrichment (8 cycles) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA). DNA concentrations were estimated using qPCR and the Kapa Library Quant Kit (Kapa Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA (200 ng) was digested with 8 U of high-fidelity ApekI (New England Biolabs, USA) at 75 °C for 2 h.
-
bioRxiv - Genomics 2019Quote: ... 20 ng of the forward backbone was amplified with Len_lib_linF and Len_lib_linR (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB); the minimal promoter and GFP was amplified from 10 ng of the pLS-mP plasmid using minGFP_Len_HAF and minGFP_Len_HAR (Supplemental Table 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8 M guanidine HCl) containing 8 units/ml and Proteinase K (P8107S, New England Biolabs Inc.) was added freshly to the digestion buffer ...
-
bioRxiv - Genomics 2020Quote: ... each sample(8 μl) was mixed with 12.5 μl 2X Quick Ligation buffer (New England BioLabs), 2.5μL T4 DNA ligase (2000U/μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...