Labshake search
Citations for New England Biolabs :
151 - 200 of 3773 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... along with 2.5 ng/μl pCFJ90(Pmyo-2::mCherry) and 77.5 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate two independent strains expressing Ex[Pcol-10::mCherry::his-58::SL2::drl-1 cDNA] (DLS515 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biochemistry 2020Quote: ... then extended and inserted into pCS2+8 or pET28a linearized with EcoRI (NEB). All inserts were fully sequenced by Sanger sequencing at the Cornell Genomics Core Facility.
-
bioRxiv - Biochemistry 2019Quote: ... Peak fractions were pooled and passed over an 8 mL amylose column (NEB), washed with 5 CV of Amylose Wash Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2020Quote: ... 15 mM HEPES pH 8) and 20 μl of DNase I (M0303S, NEB). The Nuclease Flushing mix was loaded into the flow cell and incubated for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were then successively treated with 8 U/mL DNase I (NEB; M0303S) for 5 min at 37°C and 4 U/mL RNase I for 3 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...