Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 1% BSA (20 mg/ml, NEB)) + hash oligos (1 uM ...
-
bioRxiv - Microbiology 2023Quote: ... and 20 U DNase I (NEB) were added ...
-
bioRxiv - Microbiology 2022Quote: ... and 20 U T4 ligase (NEB), and run in a thermal cycler with an initial 1 hr 37 C step followed by ...
-
bioRxiv - Microbiology 2023Quote: ... and 20 units RNase inhibitor (NEB) in 75 mM KCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 U T4 RNA ligase (NEB) was added and incubated at 25 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 20 µg factor Xa protease (NEB) and 5 mM CaCl2 with inversion at 10 °C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... and 20 µL of 20 U/µL MNase (New England BioLabs, 1/1000 dilution of commercial stock). Reactions were digested for 1 minute and quenched with 2 µL 500 mM EDTA and thorough pipetting ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... Five hundred nanograms total RNA was then reverse-transcribed in 20 μl reaction volume using the LunaScript RT SuperMix Kit (E3010, New England Biolabs, MA, USA). Quantitative PCR was performed by transferring 2 μl of the RT mix to the qPCR mix prepared with Luna Universal qPCR Master Mix (M3003 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5S and Saba PCR products were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) (NEB, # T1030). The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta ...
-
bioRxiv - Plant Biology 2023Quote: The m6A immunoprecipitation was performed from 5–day–old seedlings using the EpiMark® N6–Methyladenosine Enrichment kit (NEB) starting from 4 μg of total RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... was generated from full-length CSN-5 using a Q5 site-directed mutagenesis kit per manufacturer’s instructions (New England BioLabs). Truncated CSN-5 constructs were made by PCR from full-length CSN-5 and inserted into pGEX-KG plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA samples (5-500 ng) were hybridized with NEBNext rRNA Depletion Kit v2 (Cat# E7400; New England Biolabs) to diminish rRNA from the samples ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 μL BSA (NEB, 20 mg/mL) and 400 units of DpnII (R0543M ...
-
bioRxiv - Genetics 2021Quote: ... and 20 U SbfI (New England BioLabs), followed by incubation at 37°C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... and 20 units of HindIII-HF (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 units of either XhoI (R1046S, NEB) or AgeI (R3552S ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Exonuclease I (NEB, 20 U/μl) were added to degrade the excess TSO and RT primer for 20 minutes at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... coli RNAP core enzyme (20 nM, NEB) plus 1 μM Cy5-σ instead of RNAP holoenzyme ...
-
bioRxiv - Biophysics 2019Quote: ... 20 µL 10x T4 ligase buffer (NEB), 70 µL Millipore water and 10 µL T4 DNA ligase (NEB ...
-
bioRxiv - Biophysics 2019Quote: ... 1mM PMSF and 20 μl DNaseI (NEB)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 µl 5x GC Buffer (NEB, USA), 2 µl dNTP mix (10 mM each ...
-
bioRxiv - Genomics 2021Quote: ... 27.5 μl 20 mg/ml BSA (NEB) in water) ...
-
bioRxiv - Biochemistry 2022Quote: ... and 20 U murine RNase inhibitor (NEB). PmIleRS enzymes were present at 4 nM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1% BSA (20 mg/mL, NEB) were added onto the tissue powder and transferred to a 1.5mL tubes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 units of T4-RNA ligase (NEB), 1x T4-RNA ligase buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 nL BSA (20 ng/ml NEB) and 91.25 nL nuclease-free H2O ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.2 nL BSA 20 ng/ml (NEB), 23.3 nL 10X PNK buffer (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... 20 µl Amylose resin (New England Biolabs), 5 µg GST-tagged protein ...
-
bioRxiv - Cell Biology 2023Quote: ... or BamHI 20 U (New England Biolabs) at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... 20 U of RNase Inhibitor (NEB; M0314S) and 0.5 mM of dNTPs (Biotechnology N557-0.5ML) ...
-
bioRxiv - Biophysics 2023Quote: ... and 20 μg/ml RNase A (NEB), and lysed by passing the suspension three times through a high-pressure homogeniser (HPL6 ...
-
bioRxiv - Genomics 2023Quote: ... 20 U of T4 Polynucleotide kinase (NEB), 3.5 U of Large (Klenow ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA synthesis was performed as a 20 μl reaction using the LunaScript® RT SuperMix Kit (NEB, following the manufacturer’s protocol) and cDNA was stored short-term at −20°C before transcriptional assessment.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...