Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 20 μM Cas9 (New England BioLabs), and 5 μL of 40 μM transcribed dgRNAs ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% (v/v) BsaI at 20 U/μL (NEB #R3733), 10% (v/v ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... we performed 2 reactions per sample (20 µl 5× NEB Q5 buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ ends were phosphorylated by 20 U polynucleotide kinase (PNK; NEB) by adding 1 mM ATP (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: 5’ end phosphorylation (1x PNK buffer, 20 u T4 PNK (NEB), 80 u RNaseOUT ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 mM EDTA) + 4 μl of Proteinase K (20 mg/ml, NEB) at 55°C (300 rpm continuous shaking in a thermomixer) ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL NEBNext 5× Quick Ligation Reaction Buffer (New England Biolabs, UK), and 10 μL of Quick T4 DNA Ligase ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’ caps were removed by incubation with 20 U of RppH (NEB) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ end phosphorylation (1x PNK buffer, 20 U T4 PNK (NEB, Cat# M0201L), 80 U RNaseOUT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Immunology 2020Quote: ... Samples (20 μL) were loaded in DNA loading buffer (5 μL; New England Biolabs) and gels were run at 60 V for 120 mins.
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Plant Biology 2021Quote: ... 20–27 and the NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μl RT mastermix (2x reaction buffer, 20 mM DTT, 4U murine RNase inhibitor [NEB] ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5) (NEB, product literature). Because the error rate from the RNA polymerase was much higher than the RT and PCR steps ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ ends were radiolabelled with 20 μCi γ32P-ATP using T4 polynucleotide kinase (NEB) and separated from free nucleotides using a MicroSpin G-50 column (Cytiva) ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... the reaction product was combined with 20 μl digestion mix containing 5 μl ExoI (NEB, M0293S), 5 μl HinFI (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA (5 µg in 20 µL ddH2O) was incubated with 2µL 100U Nuclease P1 (NEB) and 2 µL 10x Nuclease P1 buffer (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... We mixed 20 µg of insert or 15 µg plasmid library with 5 µL AscI (NEB R0558L), 5 µL SbfI-HF (NEB R3642L) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 μL of plasma was lyophilized and resuspended in 20 μL 1X Rapid PNGaseF buffer (NEB #P0710S) and incubated for 15 minutes at 70°C to denature proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... 20 μg of total RNA were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) through a 16 h incubation at 16°C with 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Biochemistry 2022Quote: 3’-PUA-DNA was generated by incubation of 1 μM 5’-FAM-labeled AP-DNA (FAM_U_35) with 20 U EndoIII/Nth (NEB) in Buffer B pH 7.0 at 37 °C for 60 m ...
-
bioRxiv - Biophysics 2021Quote: ... The phosphorylated 5’-ends were subjected to RNA ligation by 20 units of T4 RNA ligase 1 (NEB) in the presence of 10 mM DNA/RNA rP5_RND oligo (Supplemental Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.2% Tween-20) and RNA 5’ ends where labelled with [γ-32P]-ATP and T4 PNK (NEB, M0201L) at 37°C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... 2 εL of 10% Tween-20 and 5 εL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Cancer Biology 2021Quote: ... We performed 5 or 20 Gibson assembly reactions for tiling or genome-wide sgRNA library followed by manufacturer’s instructions (NEB) and purified DNA using ethanol precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were subsequently resuspended in 20 μL dephosphorylation reaction mix (1X PNK buffer, pH 6.5, 5 units of T4 polynucleotide kinase (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μg of samples were processed using a commercially available kit (New England Biolabs), PrPC detection was performed using the monoclonal anti-PrPC antibody POM2 as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...