Labshake search
Citations for New England Biolabs :
4601 - 4650 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... These were then simultaneously transferred into a single vector via a Golden Gate level 1 reaction with BsaI (New England Biolabs) and a modified version of pICH4774246 ...
-
bioRxiv - Biophysics 2024Quote: ... Chromosome-bound proteins were degraded by flushing hypotonic solution supplemented with proteinase K (PKA, stock concentration of 800 units mL-1, NEB). The mix was prepared by adding 0.75 μL PKA to 20 μL hypotonic solution.
-
bioRxiv - Microbiology 2024Quote: ... The samples were incubated for 10 min at 50°C and 1 μL was used as template for a PCR reaction using Phusion DNA Polymerase (M0530S, NEB) as described (ref ...
-
bioRxiv - Microbiology 2024Quote: ... and nCoV_IP4-14084 Probe(+)TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as PFU equivalents (eqPFU ...
-
bioRxiv - Molecular Biology 2024Quote: ... The signal peptide was removed (amino acids 1-35) by mutagenesis using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Microbiology 2024Quote: ... whereas rRNA-depleted RNA was prepared from 1 μg of total RNA using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (New England Biolabs). NGS libraries were generated from poly(A)+ RNA or rRNA-depleted RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... the RNA was ligated to the 5’ adapter from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adapter-ligated RNA was reverse-transcribed using SuperScript II (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR-1 (JW45&JW49 or JW48&JW50, Supplementary File 7) was performed with Q5 Hot Start High-Fidelity DNA polymerase (NEB) following manufacturer’s protocol for 25 cycles of PCR ...
-
bioRxiv - Microbiology 2024Quote: ... the upstream flank and downstream flanking fragments of the CdpA C-terminal domain were amplified by using the primers in Supplementary Table 1 and cloned into pTA131 (at HindIII-BamHI) using Gibson assembly (NEB) as described above.
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Genomics 2024Quote: ... The recovered DNA was end-repaired and ligated to Illumina indexed adapters using the NEBNext Ultra DNA Library Prep Kit for Illumina NEB) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1: NEB). The adapter-ligated DNA underwent 6 or 8 cycles of PCR amplification ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:10 and used for qPCR reactions employing Luna® Universal qPCR Master Mix (New England Biolabs). Ct values were computed by the instrument and used for calculation of ΔΔCt using ACTB (Beta-actin ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells or islets were incubated for 24 hours post-transfection / transduction before labelling with 1 µM SNAP-Surface fluorescent probes (New England Biolabs) for 15-20 minutes for cells ...
-
bioRxiv - Pathology 2024Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplicons were analyzed by 1% agarose gel electrophoresis and purified according to the sizes using the DNA Gel Extraction Kit (NEB).
-
bioRxiv - Genetics 2024Quote: ... IVS5-IVS6) was amplified from genomic DNA isolated from Patient 1 using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with 35 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT, NEB #M0368L for ProtoScript II RT ...
-
bioRxiv - Microbiology 2024Quote: ... All three libraries were rescued post-transformation by inoculation into 1 ml of SOC outgrowth medium (New England Biolabs, B9020S) pre-warmed to 37°C and incubated with aeration at 37°C for 1 hour.
-
bioRxiv - Molecular Biology 2024Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 µL of both the strands at a concentration of 100 µM was added to 1 µL of T4 PNK (New England Biolabs), 1 µL of T4 ligation buffer and 6 µL of H2O ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid DNA was pre-digested with the Not I enzyme in a reaction containing 1 μL of CutSmart buffer (NEB), 0.5 μL of NotI-HF enzyme (NEB) ...
-
bioRxiv - Systems Biology 2024Quote: ... Annealed oligos are diluted 1:20 with DNase free water and 1uL is used in a Hi-T4 (NEB, M2622S) ligation reaction at room temperature for 1 hour ...
-
bioRxiv - Synthetic Biology 2024Quote: Golden Gate cloning reactions were performed using forty fmol of plasmid parts in a reaction mix recipe of 1 µl restriction enzyme (BsmBI-v2, Esp3I, or BsaI-HF-v2) (New England Biolabs), 1.5 µl bovine serum albumin ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Laboratory vectors and plasmid constructs (Supplementary Table 1) were purified using the Monarch Plasmid Miniprep Kit (New England Biolabs, UK). DNA fragments for cloning were amplified using Q5 DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified HIV-1C T/F LTR PCR products were cloned into the linearized C731CC lentiviral vector by ligation using 1 U of T4 DNA ligase (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting RNA’s purity was assessed by NanoDrop and run on a 1% agarose 1X TBE gel using 2X RNA Loading Dye (New England Biolabs) and stained with 1µg/mL ethidium bromide ...
-
bioRxiv - Biophysics 2024Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ratio 1:3 in the 2xHiFi mix (New England Biolabs) to obtain the final plasmid of 4175 bp ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µg of DNA origami nanoparticle was mixed with 1 U/µl DNase I (2,000 units/mL, New England Biolabs, M0303S) mixed with 10× DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: Nucleoside-modified mRNAs were produced from 1 μg of linearized template DNA using the HiScribe T7 mRNA Kit with CleanCap Reagent (New England Biolabs) according to manufacturer instructions with the following modifications ...
-
bioRxiv - Plant Biology 2024Quote: ... Annealing was performed with 1 µl of annealed sgRNA and 100 ng of linearized vector using T4 DNA Ligase (New England BioLabs). The ligation product was transformed in E ...
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Biochemistry 2024Quote: ... an aliquot of the dense DNA fraction of the second gradient was desalted and subsequently digested for 1 h at 37°C with single-strand-specific nuclease P1 and RNAseH (both New England Biolabs). Digestion-resistant DNA was purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Genomics 2024Quote: ... The NNK ultramers and the replication oligo pool were extended in a 1-cycle PCR (Q5 high-fidelity DNA polymerase, NEB) with primers TSO_2 and TSO_65 (Supplementary Data File 5) ...
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of the 1:10 diluted adapter-ligated library aliquot were amplified in 10-µl reactions containing 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEB_mws20 primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (IDT) ...
-
bioRxiv - Genomics 2024Quote: ... PCR that was performed in 60 µl reactions as follows: 20 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pre-amplified for 14 cycles against a pool of primers (Extended Data Table 1) using PreAmp Grandmaster mix (TATAA Biocenter) before exonuclease I treatment (NEB). Pre-amplified cDNA was diluted at least five-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad ...
-
bioRxiv - Genomics 2024Quote: ... Δ([fimB or yjiT]-opgB)114::IS10 Δ(dcm::FRT1)1) and the dcm+ (DHB4, GenBank accession: CP014270.1) genomic DNA were obtained from NEB. The m4C containing genomic DNA from Natrinema pallidum BOL6-1 archaea was also obtained from NEB.
-
The ATP-dependent protease ClpYQ degrades cell division proteins DivIVA and Mbl in Bacillus subtilisbioRxiv - Biochemistry 2024Quote: ... Reaction mixtures were prepared with a 25 μL final volume and contained 1 X Φ29 DNA polymerase reaction buffer (NEB), 0.1 mg/mL recombinant albumin (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... The HT-PAMDA substrate libraries containing the four control plasmids (combined at a ratio a 1:100 control plasmid pool to HT-PAMDA library) were linearized with PvuI-HF (NEB) before performing HT-PAMDA previously described18,37.
-
bioRxiv - Biochemistry 2024Quote: Transgene template RNAs and mRNAs for cellular transfection were made using 1 ug of plamid fully linearized with BbsI (NEB) for 4 h at 37 °C and purified with PCR purification kit (QIAGEN ...
-
Single-molecule analysis reveals the mechanism of chromatin ubiquitylation by variant PRC1 complexesbioRxiv - Biophysics 2024Quote: ... a 5-10 fold excess of the annealed and labeled chromatin anchor was added to 130 µg of BsaI-digested chromatin DNA in 400 µl of 1× T4 ligation buffer along with 50 units of T4 ligase (NEB) per 1ug of chromatin DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... Five ligation reactions (20 µL each) were set up using 100 ng DNA (3:1 ratio of library to backbone) and T4 ligase (NEB). Ligation occurred at room temperature for 30 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 µL of reaction mixture containing 1 µg of template was prepared for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and incubated overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... A plasmid expressing HIV-1 Gag with an internal EGFP tag was generated using the NEB HiFi Assembly Kit (New England Biolabs). A lentiviral backbone containing a tetracycline-inducible promoter and a gene encoding rtTA was prepared by digesting the pCW57.1 plasmid (Addgene #41393 ...