Labshake search
Citations for New England Biolabs :
401 - 450 of 1885 citations for Recombinant Human C mer Proto Oncogene Tyrosine Kinase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Probes were labeled with ATP-P32 using T4 polynucleotide kinase (NEB®) and blot was exposed to a phosphor screen (GE® ...
-
bioRxiv - Genetics 2022Quote: ... The three regional oligo pools were phosphorylated using T4 Polynucleotide Kinase (NEB) as recommended by the provider using 300 pmoles of each oligo pool and incubation for one hour at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and phosphorylated at the 5’ termini by T4 Polynucleotide Kinase (NEB, M0201L). The pBluescript plasmid was cut by EcoRV and dephosphorylated by Calf Intestinal Alkaline Phosphatase (CIP ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicons were incubated with T4 polynucleotide kinase (New England Biolabs, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Guides were inserted into vectors using T4 polynucleotide kinase (New England Biolabs), and the final combined guide RNA vector was assembled by Golden Gate Assembly using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Biophysics 2021Quote: The NNS primers were phosphorylated with T4 polynucleotide kinase (NEB, cat#M0201S). 20 μL phosphorylations was prepared according to the following recipe ...
-
bioRxiv - Genomics 2021Quote: DNA end modification: 10 U T4 Polynucleotide Kinase (New England Biolabs, M0201) in 60 μl 1×T4 DNA Ligase reaction buffer were added to each sample and incubated at 37°C for 30 minutes.
-
bioRxiv - Cell Biology 2021Quote: ... A positive control was prepared by substituting casein kinase II(NEB, P6010S) for galectin 3 in the reaction mixture.
-
bioRxiv - Genomics 2021Quote: ... The 3’ ends were dephosphorylated with T4 polynucleotide kinase (T4 PNK; NEB) in the following reaction mix ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA samples were treated with polynucleotide kinase (New England BioLabs, Cat. #M0201) to remove the 3’-phosphate group from the uncharged tRNA followed by ligation to 5’-adenylated uniquely barcoded adapters using RNA ligase 2 truncated KQ (New England BioLabs ...
-
bioRxiv - Genomics 2022Quote: ... 6.5ul of T4 polynucleotide kinase 10U/μl (New England Biolabs cat. #M0201L) 1.3ul of Klenow polymerase 5U/μl (New England Biolabs cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was blunt-end repaired with T4 Polynucleotide Kinase (New England Biolabs), followed by a reaction clean-up with the MinElute purification kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... specific primers (Supplementary Table S1) were radiolabelled with T4 Polynucleotide kinase (NEB) and [?-32P]ATP (6,000 Ci/mmol) ...
-
bioRxiv - Molecular Biology 2022Quote: ... prepared by labelling of oligodeoxyribonucleotide using T4 polynucleotide kinase (New England BioLabs) and ATP or [γ32P]-ATP (Perkin-Elmer ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was then de-phosphorylated by incubating with T4 polynucleotide kinase (NEB) for 1 hr at 37° C ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation of RNA fragments was achieved using T4 Polynucleotide Kinase (NEB) and Adenosine 5’-Triphosphate (ATP ...
-
bioRxiv - Microbiology 2023Quote: ... by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs) at 37°C for 1 h.
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Biophysics 2022Quote: ... and 10 units of T4-polynucleotide kinase (New England BioLabs, Ipswich, MA) in 70 mM Tris/HCl pH7.6 ...
-
bioRxiv - Cell Biology 2023Quote: ... Kinase reactions were performed with 1 μL commercial CK1δ (New England Biolabs) in 1x PMP buffer supplemented with 100 μM unlabeled ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... nucleic acids extracted from SPARDA were phosphorylated by T4 polynucleotyide kinase (NEB) according to the manufacturer’s protocol and were separated by 18% PAGE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and end repaired with T4 Polynucleotide Kinase (T4 PNK; NEB, catalog # M0201) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads were treated with 10 μl of T4 Polynucleotide kinase (PNK; NEB) in 100 μl of 1X T4 PNK Reaction buffer containing 1 U/μl SUPERase•In™ RNase Inhibitor at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... The ATP and ADP makers were created using T4 polynucleotide kinase (NEB). T4 PNK mixed with 128 µM ATP supplemented with 10 nM [α-32 P]-ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...
-
bioRxiv - Molecular Biology 2021Quote: ... SET8 recombinant enzyme (New England Biolabs # M0428S) was incubated with recombinant active PARP1 (Trevigen # 4668-100-01 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3µl recombinant AsiSI endonuclease (10U/µL, NEB) was added to three biological replicates and incubated (2 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (rSAP, NEB) overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (all NEB) at 37°C overnight ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.2 mg/mL recombinant albumin (NEB B9200S), 1 μM RT primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was phosphorylated for 1 h at 37oC with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Molecular Biology 2020Quote: Yeast total RNA was first treated with T4 Polynucleotide Kinase (PNK) (NEB M0201S) in order to remove possible phosphorylated 3’ends before polyA tailing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unprobed and probed RNAs were treated with T4 Polynucleotide Kinase (PNK) (NEB, M0201S) as described above before proceeding with ONT Direct cDNA sequencing.
-
bioRxiv - Genomics 2019Quote: ... the RNA was gel extracted and was dephosphorylated using polynucleotide kinase (NEB #M0201S). A Universal miRNA cloning linker (NEB # S1315S ...
-
bioRxiv - Microbiology 2019Quote: ... RNA fragments were dephosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA), precipitated ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Biophysics 2021Quote: ... pH 8.4 using cAMP-dependent protein kinase A (New England Biolabs, Frankfurt, Germany). The phosphorylated vimentin was mixed at the desired ratios of 1 ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Cancer Biology 2022Quote: Oligos of the gRNAs were annealed with T4 polynucleotide kinase (New England Biolabs) by PCR ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was removed 3’phosphoryl groups using T4 Polynucleotide Kinase (New England Biolabs) in the buffer (70 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Microbiology 2022Quote: RNAs for direct cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer’s non-radioactive phosphorylation protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligo pairs were annealed and phosphorylated by T4 Polynucleotide kinase enzyme (NEB, M0201S), chloroform extracted ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA primer end-labeling was accomplished using T4 polynucleotide kinase (T4 PNK, NEB) and 25 μCi of ATP ...
-
bioRxiv - Microbiology 2019Quote: ... Extracted crRNAs were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, MA, USA), radiolabeled with γ-[32P]-ATP (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... An aliquot of the purified amplicons was phosphorylated using T4 Polynucleotide Kinase (NEB) using the manufacturer’s recommended reaction mixture and we extended the incubation ...