Labshake search
Citations for New England Biolabs :
401 - 423 of 423 citations for Goat anti mouse HRP secondary antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were separated by SDS-PAGE and detected by immunoblotting using anti-MBP (New England BioLabs, E8032S), anti-GST (MBL ...
-
bioRxiv - Systems Biology 2023Quote: ... and the sense and anti-sense crRNA oligos were annealed and phosphorylated with T4 PNK (NEB, M0201). The linearized pRG212 vector and crRNA oligo were then ligated with T4 DNA Ligase (M0202).
-
bioRxiv - Plant Biology 2023Quote: ... a CP29A specific rabbit antisera (Kupsch et al., 2012) or anti-SNAP rabbit antisear (NEB, Frankfurt, Germany) in 1:2000 dilution overnight at 4°C and subsequently washed with TBST buffer four times at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL phosphorylation mix (1µL 100mM sense oligo, 1µL 100mM anti-sense oligo, 0.5µL 25mM ATP (BioLabs #P0756S), 1µL 10X PNK T4 Buffer (BioLabs #B0201S) ...
-
bioRxiv - Plant Biology 2022Quote: ... and the ubiquitinated ERECTA_CD were detected by IB analysis with anti-MBP (E8032, 1:10,000, New England Biolabs) as primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... modified conditions were used: GTPs were replaced by GTPs mixed with Anti Reverse Cap Analog (New England BioLabs) at the ratio of 1 to 4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... The scAAV-control contains an expression cassette for an anti-GFP scFv (Restriction enzymes were from New England Biolabs Canada ...
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche) ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA used in this study was capped with either m7G (Anti-Reverse Cap Analog [ARCA], S1411L) or ApppG cap analog (S1406S, New England Biolabs).
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 15 µl of anti-MBP couped beads (pre-blocked for 1h in RIPA with 3 % BSA; NEB) for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole brains were blocked at RT for 1 h in PBT containing 0.5% BSA and 5% NGS (PBANG) and then incubated in PBANG containing rabbit anti-GFP (1:100; Torry Pines Biolabs, TP401) at 4°C for 2 nights ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...