Labshake search
Citations for New England Biolabs :
251 - 300 of 423 citations for Goat anti mouse HRP secondary antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Primary antibodies used were from Cell Signalling Technologies (New England BioLabs, ON, CAN). They included phosphorylated and total extracellular signal-regulated kinase (P-ERK 1/2 ...
-
bioRxiv - Biochemistry 2022Quote: The plasmid CM13d3 (Antibody Design Labs) was digested with SacI (New England Biolabs) for 10 hours at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... or anti-H3K9bhb (PTM Biolabs cat # PTM-1250) diluted 1:2,000 in blocking solution ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pan anti-trimethyllysine (rabbit, PTM Biolabs, PTM-601), SETD2 (rabbit ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-insulin was from Sigma (I-2018) and anti-SNAP from NEB (P9310S). The coverslips were mounted on glass slides with VectaShield Antifade Mounting Medium and fixed with nail polish ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Gaussia luciferase (E8023, New England Biolabs) at a 1:2,000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-malonyl-lysine (PTM Biolabs, Cat. #PTM-901), anti-succinyl-lysine (PTM Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... and pan anti-acetyllysine (PTM-105, PTM Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... anti-glutaryl-lysine (PTM Biolabs, Cat. #PTM-1151), anti-ACC (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-succinyl-lysine (PTM Biolabs, Cat. # PTM-401), anti-glutaryl-lysine (PTM Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-H4K12la (PTM BIOLABS, 1:1000, PTM1411RM). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-succinyllysine (PTM Biolabs, PTM-401, 1:1000), anti-MYC (and anti-SUCLG2 (Bethyl Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... or rabbit anti human HMGA2 (New England Biolabs), ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Knockout was confirmed in mouse genomic DNA extracted using Monarch Genomic DNA Purification kit (New England Biolabs, Ref T3010S) followed by PCR amplification of the surrounding ∼500bp next to the sgRNA target site ...
-
bioRxiv - Cancer Biology 2020Quote: Specific antibodies against Slug (C19G7, Cell Signaling Technology, NEB, Frankfurt, Germany, #9585, 1:400), pan-cytokeratine (polyclonal ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Microbiology 2021Quote: ... plates were immunostained using a monoclonal antibody against SARS-CoV2 nucleoprotein (Creative-Biolabs; NP1C7C7) at a dilution of 1:1000 followed by 1:5000 anti-mouse IgG monoclonal antibody and was developed using KPL TrueBlue peroxidase substrate for 10 minutes (Seracare ...
-
bioRxiv - Cancer Biology 2020Quote: ... and murine lung slices were incubated overnight with primary antibodies in 0.1% BSA as follows: anti-CDH1 (clone EP700Y, Biozol, 1:250) or anti-CDH1-Alexa-488 (clone 24E10, New England Biolabs, 1:50), anti-Twist1 (clone Twist2C1a ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated with mouse anti-CaMKIIα (6G9) (1:1000, Pierce Biotechnology, Catalog #MA1-048) and rabbit anti-Gaussia luciferase (1:1000, New England BioLabs, Catalog #E8023S) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... whereas rRNA-depleted RNA was prepared from 1 μg of total RNA using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (New England Biolabs). NGS libraries were generated from poly(A)+ RNA or rRNA-depleted RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: Enhancers were cloned from human or C57Bl/6J mouse genomic DNA using enhancer-specific primers and Phusion high-fidelity polymerase (M0530S; NEB). Individual enhancers were then inserted into a recombinant single-stranded pAAV backbone that contained the beta-globin minimal promoter ...
-
bioRxiv - Developmental Biology 2024Quote: ... E14.5 mouse brain cDNA amplified with primers pairs XR293-XR296 and cloned into pCAG-HF-IRES-EGFP by Gibson Assembly (NEB).
-
bioRxiv - Biochemistry 2024Quote: ... Histones were extracted from mouse testis as described above and digested overnight with Glu-C endoprotease (V1651, New England BioLabs) at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Bulk RNA sequencing of K562 cells at 37°C was conducted by generating a cDNA library prepared by depleting rRNA using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) and then the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-Kcr (Catalog No. PTM-501, PTM Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... anti-Tubulin (1:2500 dilution, PTM Biolabs, PTM-1011), and anti-ubiquitination (1:2500 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-MBP (E8032, 1:10,000, New England Biolabs) antibodies ...
-
bioRxiv - Developmental Biology 2024Quote: ... or anti-MBP (New England Biolabs E8032, 1:5,000), goat anti-mouse IRDye 800 (Li-Cor Biosciences 926-32210 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-cleaved caspase-3 1:100 (9661, NEB), rat anti-p21 1:100 (ab107099 ...