Labshake search
Citations for New England Biolabs :
401 - 450 of 5185 citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... m7G(5’)G RNA Cap Analog (NEB) or Anti-Reverse Cap Analogue (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 U of Exonuclease I (ExoI, NEB) were added to the PCR mix and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... and 5 μl Murine RNase Inhibitor (NEB). Worm lysate was cleared by centrifugation at 20,000 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... To supernatant 5 μl 10x CutSmart (NEB) was added and incubated with 20 units ExoI nuclease (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 polynucleotide kinase (NEB), and 25 μL of DEPC H2O and incubating at 25 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 DNA polymerase (NEB), 1 μL of Klenow DNA polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl 10X CutSmart buffer (NEB B7204S) and 0.5 µl BbsI or BsaI_HFv2 (the enzyme used for the cloning reaction) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 mM sodium orthovanadate (New England Biolabs), and 10 mM sodium fluoride (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl of Gibson assembly mastermix (NEB) and dH2O up to 10 µl were mixed and incubated at 50°C for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... and Antarctic phosphatase (5 U/μl, NEB) in a ratio of 1:10:20 ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% dimethyl sulfoxide (DMSO, New England BioLabs), 0.12% triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha cells (NEB). Transformed cells were plated on LB agar containing spectinomycin (0.1 g L-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... NEB 5-alpha cells (New England Biolabs) were transformed with pAAV constructs and the integrity of inverted terminal repeats and expression-related elements in selected clones were confirmed by sequencing and restriction digests ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl T4 DNA ligase (both NEB) and 5 µl FastDigest Eco31I (BsaI isoschizomer from ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used as a cloning strain ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used for construction and propagation of plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... 5 units of restriction enzyme EcoRI (NEB) were added to the nucleosome array in the absence and presence of DBDC/EBP⍺ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) and LB Miller medium (Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 5 U AMV-RT (NEB, M0277S) and gene-specific reverse primers ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Genetics 2023Quote: ... followed by 5′ phosphorylation (New England BioLabs), repurification ...
-
bioRxiv - Genomics 2023Quote: ... and/or BglII (5 U, NEB, R0144L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL dNTPs (New England Biolabs #N0447L), 2.5 μL SUPERase In ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... and 5′ hydroxyl repair with PNK (NEB). The 5′ adapter was ligated with T4 RNA ligase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... and 5 units of EPAP (NEB, M0276L). The reaction was incubated at 37°C for 5 min ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM, ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ITS PCR reactions were performed in 25 μl with the following composition: 5 μL 5× buffer containing MgCl2 at 1.5 mM (New England Biolabs), 0.1 mM each dNTP ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2022Quote: ... washing and TRIzol extracted followed by removal of the 5’ cap with 10 U of 5’-pyrophosphohydrolase (RppH) (NEB) and 5’ end repair with T4 PNK (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... AMX sequencing adaptors were ligated by mixing 2.5 ul of the assembly mix with 5 ul AMX and 5 ul Blunt/TA mastermix from NEB and incubated for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Genomics 2024Quote: For a typical blunting reaction 5-50 ng of cfDNA are mixed with 5 μl of CutSmart 10x (NEB), 5 μl of dNTPs 1mM each ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of 5 μl of UDG reaction solution (New England Biolabs, 0.02 U μl−1 UDG in 1X UDG buffer) and an additional 30 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was slowly cooled down to room temperature with a Δ -1°C / second gradient and 0.5 μl of each RNase H (NEB, 5 U/μl), RNase T1 (ThermoFisher Scientific ...