Labshake search
Citations for New England Biolabs :
251 - 300 of 5185 citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Both the 2 kb spacer and 1.5 kb biotin handle DNA were ligated to 5’-CGGT 1 µm polystyrene oligo beads overnight at 16 °C using T4 DNA ligase (NEB). The ligated beads were first washed with TE + 0.5 M KCl + 20 µg/mL β-casein ...
-
bioRxiv - Biochemistry 2020Quote: ... The region harboring the randomized hexamer and flanking constant tags was amplified from 1 µg ssDNA for 5 cycles using the Q5 Hot Start High-Fidelity PCR Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... The hygR insert and the inverse PCR product of the pEX18Ap backbone were mixed at a 5:1 ratio and ligated for 30 minutes at 50°C with New England Biolabs (NEB) Gibson Assembly ® Cloning Kit to create pEX18HygB ...
-
bioRxiv - Microbiology 2020Quote: ... 3-5 μg of RNAse H treated RNA was circularized using T4 RNA ligase 1 (ssRNA Ligase, New England Biolabs), RNA was extracted with phenol/chloroform approach and ethanol precipitated ...
-
bioRxiv - Genomics 2022Quote: ... The TdT reation was prepared using 4 μL of the resulting elutant and 5 μL of ice-cold TdT mix (standard Quartz-seq2 condition: 1× Thermopol buffer [New England Biolabs] ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The vector and insert DNA fragments were assembled in a ratio of 1:5 using NEBuilder HiFi DNA Assembly (E5520S, New England Biolabs). The gl2L480P ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-5 uL of the cDNA product was PCRed with Phusion Hot Start Flex DNA Polymerase (New England BioLabs, M0535S), using a barcoded version of SGR-176 and a version of the 10x Genomics cDNA primer that included a P5 addition ...
-
bioRxiv - Systems Biology 2019Quote: ... the sRNA gene of interest was cloned at the transcriptional +1 site under Para control by amplifying the pBAD+1 plasmid (Supplementary Table 5) by inverse PCR using Q5 DNA Polymerase (NEB). The pBAD+1 template is derived from pBADmycHisA (Tree et al. ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesised with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extracted DNA fragments were incubated in a ratio of 1:3 of plasmid to insert (1:5 for inserts smaller than 300 nucleotides) in the presence of Gibson Assembly master mix (NEB) at 50°C for 1 hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5–1 μg of circFL-seq cDNA was repaired and dA-tailed by the NEBNext FFPE DNA Repair Mix (NEB) and NEBNext Ultra II End repair/dA-tailing Module (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription was initiated upon addition of 4 nM of dsDNA template (gblocks Gene Fragment, IDT) to a solution of 5 U.μL-1 of T7 RNA polymerase (NEB, M0251), 1 U.μL-1 of murine RNase Inhibitor (NEB M0314) ...
-
bioRxiv - Immunology 2022Quote: ... Resulting mRNA products were capped with a 5’-Cap 1 structure using vaccinia capping enzyme (New England Biolabs, Ipswitch, MA) and Vaccinia 2’ O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3′ RNA adaptor (/5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...