Labshake search
Citations for New England Biolabs :
401 - 450 of 5887 citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... along with 5 ng/μl Pmyo-3::GFP and 20 ng/μl of 2-Log DNA ladder (New England BioLabs), to generate the DLS344 strain ...
-
bioRxiv - Cell Biology 2024Quote: ... we microinjected 5 ng/μl Pmyo-3::GFP and 95 ng/μl of 2-Log DNA ladder (New England BioLabs) into the germline of GRD-3::mKate2 animals to generate transgenics expressing a muscle-specific GFP marker.
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified extension products were denatured and ligated to adaptor 2 (Ad2, Supplementary Table 3) by Instant Sticky-end Ligase Master Mix (New England Biolabs) at 4 °C overnight ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 uL of T4 RNA ligase I (NEB M0204S) totaling 20 uL and incubated for 1 hour at 30 C.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10X RtcB reaction buffer (New England Biolabs), 2 μl 1mM GTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by adding 2 μl of RNase A (NEB) and incubating at 37 °C for 45 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1x T4 RNA Ligase 2 reaction buffer (NEB, M0239S), and 0.5 units/µl T4 RNA Ligase 2 (NEB ...
-
bioRxiv - Genomics 2020Quote: ... the NEBNext High-Fidelity 2× PCR Master Mix (NEB) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Genomics 2021Quote: ... 25 μL NEBNext HiFi 2× PCR Master mix (NEB) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 unit of murine RNase inhibitor (New England Biolabs), varying amounts of target RNA ...
-
bioRxiv - Bioengineering 2021Quote: ... Its constituents were 1X RNA Ligase 2 buffer (NEB) supplemented with 5% PEG 8000 ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by incubation with 2 Units USER enzyme (NEB) for 10 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... packed with 2 ml amylose resin (New England Biolabs) equilibrated with buffer AF ...
-
bioRxiv - Genomics 2022Quote: ... 0.7 µl T4 ligase (2 M U/ml, NEB), 250 ng DNA (adapters in File S1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 units of phi29 DNA polymerase (New England Biolabs), three not to quantified deoxynucleoside triphosphate mix (20 μM) ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μl Phusion DNA polymerase (2 U/μl, NEB), 160 μl Taq DNA ligase (40 U/μl ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of undiluted Thermolabile Proteinase K (NEB #P8111S) and 1 μl SUPERaseIN (20 U/μl ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μl of 10 mM dNTPs (New England Biolabs), 2.5 μl of 10 μM oligonucleotide A (unmodified forward primer ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by incubation with 2 Units USER enzyme (NEB) for 10 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... for 2 hours or ShortCut RNaseIII (New England Biolabs) for 20 minutes at 37°C after permeabilization before blocking.
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5 vol 2×Phusion Master Mix (New England Biolabs), and 0.04 vol P1 and P2 amplification primers (10 nm) ...
-
bioRxiv - Genomics 2021Quote: ... 2uL 2 000 000U T4 DNA ligase (NEB, M0202). The reaction was incubated at room temperature for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 1X Phusion buffer and 2 U Phusion Polymerase (NEB). The PCR protocol used was an initial denaturation of 30 s at 98 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of 10% NP-40 (NEB Cat # B0701S) and 6 μL of water were mixed with the 10 μL of denatured spike glycoprotein ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μl NEBuffer 2 (New England Biolabs, Ipswich, USA); 0.3 μl T7E1 enzyme at 10 Units/μl (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μL NEBNext HiFi 2 × PCR Master mix (NEB) was added ...
-
bioRxiv - Genomics 2022Quote: ... 2 µL 400U/µL T4 DNA ligase (NEB, #M0202V), 10 µL 10mM ATP (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2 mM MnCl2 (New England Biolabs, NEB). Control treated cells were incubated with a volume of 50% glycerol equivalent to the volume of RNase III added as well as 2 mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2 mM MnCl2 (New England Biolabs, NEB). Control treated cells were incubated with a volume of 50% glycerol equivalent to the volume of RNase III added as well as 2 mM MnCl2 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 2 µl of 10X ExoI buffer (NEB, B0293S). The annealing was performed in a thermocycler by gradually decreasing the temperature from 98 °C to 60 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... BamHI (Site 2) or HindIII (Control; New England Biolabs) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 U T4 RNA ligase 2 (truncated KQ, NEB) and 40 U Murine RNase Inhibitor (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 10 µl of 2% BSA (NEB, B9000S, 0.01% final) and 930 µl of nuclease-free water and supplemented with 1U/ml Protector RNase inhibitor (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 6,25µl of LongAmp Taq 2✕ Master Mix (NEB), 4,25µl of milliQ water ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µL of PNGase F (New England Biolabs, MA) was added ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of 10x Standard Taq Reaction Buffer (NEB), 0.4 μL of dNTPs (2.5 μM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 units of DNase I (New England Biolabs, M0303S) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µl PNGaseF (P0705L, Glycerol-free, New England Biolabs) was added and incubated for one hour at 57⁰C ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA Cap 2’-O-methyltransferase (NEB, catalog #M0366S). We then added a 3′-poly(A ...
-
bioRxiv - Genomics 2022Quote: ... and 2 mg/mL proteinase K (New England Biolabs). The tissue sections were lysed separately in 75 μL lysis buffer for 2 hours at 55 °C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 mM of rNTPs (New England Biolabs GmbH (Germany)) ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended with 1.11× NEBuffer 2 (B7002, NEB) containing 0.1% sodium dodecyl sulfate (SDS) ...