Labshake search
Citations for New England Biolabs :
351 - 400 of 5887 citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of 10 mM ATP (NEB, #B0756AVIAL), 1 µL of E ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 U/mL yeast inorganic pyrophosphatase (NEB®) and 1000 U/mL murine RNase inhibitor (NEB®) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 μl RppH (NEB product number M0356S), followed by incubation at 37°C for 1 hr ...
-
bioRxiv - Genomics 2024Quote: ... contained 2 μL ENDOIV (NEB, 10 U/µL), 1 μL BST DNA Polymerase FL (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL 10X Exonuclease I reaction buffer (NEB), 13 µL water ...
-
bioRxiv - Immunology 2024Quote: ... 2 uL of Rapid PNGase F Buffer (NEB) was added and incubated at 80°C for 3 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... Then 2 μL 10x RNA ligation buffer (NEB), 0.2 μL 100 mM ATP ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µL of 10X Thermo PCR buffer (NEB), 2 µL of ES-E14 wildtype cDNA template or from 1 µL plasmid pLJM1-EGFP for GFP esiRNAs ...
-
Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-viral hsa-miR-132 ProcessingbioRxiv - Molecular Biology 2024Quote: ... 10 units of T4 dsRNA Ligase 2 (NEB) were then added to the solution and incubated for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μl of Truncated T4 RNA Ligase (NEB), 1X ligation buffer (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... and HindIII (NEB, R3104S, 2 unit/μg DNA) of Plasmid pUC19 (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl of 20 mg/ml RNaseA (NEB) was added to the reaction and the reaction was incubated at room temperature for 5 minutes before quenching the reaction with 50 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... containing 2 U of T5 exonuclease (NEB, M0363S), 12.5 U of Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... 2 kU of Taq DNA ligase (NEB, M0208S), 0.2 M Tris-HCl (pH 7.5) ...
-
bioRxiv - Biophysics 2024Quote: ... using T4 RNA ligase 2 (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... 2) the NEBNext End Repair Module (NEB, E6050S) was used for repair of DNA ends after shearing ...
-
bioRxiv - Genomics 2024Quote: ... and 2 U Quick CIP (NEB, cat# M0525S) in digestion buffer (10 mM Tris ...
-
bioRxiv - Genomics 2024Quote: ... with 2% BSA and resuspended in NEB+ (NEB with 2% BSA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 10X CutSmart® buffer (1X final) and 2 μl of 1U/μl USER® II enzyme (M5505S, NEB) (0.1U/μl final ...
-
bioRxiv - Microbiology 2020Quote: ... stained with a mAb cocktail composed of SARS-CoV-2 spike (Creative-Bios; 2BCE5) and SARS-CoV-2 nucleoprotein (Creative-Biolabs; NP1C7C7) followed by anti-Mouse IgG-HRP (Abcam ab6823 ...
-
bioRxiv - Genomics 2021Quote: ... and supernatant was transferred to a new tube and added to 2 μL 10% SDS and 2 μL 20 mg/mL proteinase K (New England Biolabs P8107). Samples were incubated overnight at 65°C to reverse crosslinks ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of 100 ng/µLcDNA diluted from the previous step was combined with 2 µL of block mix and 2 µL of nuclease free water (NEB, AM9937), and then the cDNA block oligo mix was incubated on a thermocycler under the following conditions to allow block oligo mix to bind to the 5′ end and the 3′ end of the cDNA molecule ...
-
bioRxiv - Microbiology 2023Quote: ... antibiotic resistance cassette and 2 flanking regions were combined in equimolar amounts and mixed with 2 x HiFi reagent (NEB, UK) and incubated at 50°C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... and NEBNext Multiplex Oligos for Illumina Primer sets 1 and 2 (New England Biolabs). The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μL RT Adapter (RTA)(SQK-RNA002) and 2 μL T4 DNA Ligase (NEB) were mixed together and incubated under 25 °C for 10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB Set 1 E7335 and Set 2 E7500S). Additional AMPure clean-ups at the start and the end of library preparation were included ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, M0242, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting PCR amplicons were denatured and re-annealed in 1 × NEB buffer 2 (NEB) in a total volume of 9 μl using a following conditions ...
-
bioRxiv - Genomics 2023Quote: ... 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs), 160 µL of 40 U µL-1 Taq DNA ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL of Buffer 2 and 0.5 µL of rSAP (New England Biolabs, M0371S) pre-mixed with 0.5 µL of 50% glycerol were added ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2024Quote: ... attB plasmid containing genes for tdMCP-protein fusions and a MS2-circRNA barcode were digested overnight at 37°C to remove existing barcode sequence (2 μg plasmid, 5 μL 10x CutSmart buffer, 2 μL BsrGI-HF (NEB cat#R3575S), nuclease-free water to 50uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was digested by combining the following and incubating overnight at 37°C: 2 μg plasmid + 5 μL CutSmart buffer (10x) + 2 μL AflII (NEB cat# R0520S) + 2 μL BlpI (NEB cat# R0585S ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...