Labshake search
Citations for New England Biolabs :
401 - 450 of 3773 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) and LB Miller medium (Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 5 U AMV-RT (NEB, M0277S) and gene-specific reverse primers ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Biophysics 2023Quote: ... 5 units of restriction enzyme EcoRI (NEB) were added to the nucleosome array in the absence and presence of DBDC/EBP⍺ ...
-
bioRxiv - Genetics 2023Quote: ... followed by 5′ phosphorylation (New England BioLabs), repurification ...
-
bioRxiv - Genomics 2023Quote: ... and/or BglII (5 U, NEB, R0144L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL dNTPs (New England Biolabs #N0447L), 2.5 μL SUPERase In ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli cells (NEB® 5-alpha, NEB) as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used for construction and propagation of plasmids ...
-
bioRxiv - Genomics 2024Quote: ... and 5 units of EPAP (NEB, M0276L). The reaction was incubated at 37°C for 5 min ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM, ...
-
bioRxiv - Genomics 2024Quote: ... and 5′ hydroxyl repair with PNK (NEB). The 5′ adapter was ligated with T4 RNA ligase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ITS PCR reactions were performed in 25 μl with the following composition: 5 μL 5× buffer containing MgCl2 at 1.5 mM (New England Biolabs), 0.1 mM each dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB] ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2022Quote: ... washing and TRIzol extracted followed by removal of the 5’ cap with 10 U of 5’-pyrophosphohydrolase (RppH) (NEB) and 5’ end repair with T4 PNK (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... AMX sequencing adaptors were ligated by mixing 2.5 ul of the assembly mix with 5 ul AMX and 5 ul Blunt/TA mastermix from NEB and incubated for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Genomics 2024Quote: For a typical blunting reaction 5-50 ng of cfDNA are mixed with 5 μl of CutSmart 10x (NEB), 5 μl of dNTPs 1mM each ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each 8-sample pool was then Qbit quantified and amplified using Phusion high-fidelity PCR (New England Biolabs) with a PCR primer with one of three unique barcodes ...
-
bioRxiv - Biochemistry 2019Quote: ... The sample was then further purified by a second affinity step over an 8 mL amylose column (NEB), where it was washed with 3 CV of Amylose Wash Buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2019Quote: ... excess gel was removed and embedded specimen were placed in digestion buffer (1X TAE, 0.5% Triton X-100, 0.8 M guanide HCL) with 8 units/ml Proteinase K (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... we amplified 20 ng of the library with HSS-pGL4_F and HSS-pGL4_R1 (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB) for 16 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... 8 cycles of PCR amplification were performed using NEBNext® Q5 Polymerase 2X Master Mix (New England Biolabs), according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The final cDNA libraries were amplified (cycle number of 8) using NEBNext Multiplex Oligos for Illumina (NEB, E7335) and purified using SPRIselect size selection beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... all samples were amplified by a 8-cycle PCR-program using Phusion High-Fidelity DNA Polymerase (NEB #M0530L) using primers 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ ...
-
bioRxiv - Genomics 2023Quote: ... the oxidized DNA was purified with 1.8X Ampure XP beads and eluted in 8 μL elution buffer (NEB). The DNA was denatured by adding 2 μL 0.1 M freshly diluted NaOH and incubation at 50°C for 10min ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of the assembled mix (∼5 ng of vector backbone) was transformed into competent cells (NEB, cat# C2987H), followed by spreading on antibiotic-selective LB agar plates ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...