Labshake search
Citations for New England Biolabs :
601 - 650 of 3773 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: mRNA capping reaction was performed with purified IVT mRNA using 3’-O-Me-m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB, USA). The reaction condition was followed according to supplier’s manual ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples with RNA Integrity Number > 8 were used for library preparation following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Library construction and sequences was carried out at the Biomedical Research Centre Sequencing Facility (University of British Columbia ...
-
bioRxiv - Molecular Biology 2020Quote: ... PEARL extracts from cultured cells were treated with either DNase I (1 unit per every 8 μL of PEARL extract, New England BioLabs) or with RNase A (0.1 mg per every 8 μL of PEARL extract ...
-
bioRxiv - Cell Biology 2022Quote: ... In-house adapters containing 8-nucleotide unique molecular identifier (UMI) sequences were ligated onto the DNA fragments with T4 DNA ligase (NEB). Excess adapters were removed by AMPure XP beads (Agencourt ...
-
bioRxiv - Genomics 2019Quote: ... We quantified DNA using a Qubit dsDNA BR assay and performed a debranching treatment on 8-10 µg of DNA in 100 µL reactions containing 50 Units of endonuclease T7E1 (New England Biolabs) in 1X NEB buffer 2 ...
-
bioRxiv - Genetics 2019Quote: The mutations comprising the pol30-8 allele (R61A, D63A) were introduced into pEAA578 (POL30∷KANMX) by Q5 site-directed mutagenesis (New England Biolabs) to create the single step integrating vector pEAA633 (pol30-8∷KANMX) ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Microbiology 2021Quote: ... the codon optimized RBD was PCR amplified and cloned into the bicistronic pDZ rescue plasmid system for A/Puerto Rico/8/1934 using the NEBuider HiFi DNA assembly kit (NEB). Specifically ...
-
bioRxiv - Molecular Biology 2020Quote: ... The converted RNA was fragmented into 150 - 200 nt fragments by incubation at 94 °C for 8 minutes in fragmentation buffer (NEB). The fragmented RNA was then used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of the Klenow reactions were retrieved and added to 8 µL of 2x RNA Loading Dye (New England Biolabs). The mixtures were then analyzed by electrophoresis through a urea-15% polyacrylamide gel (Novex TBE-Urea gel 15% ...
-
bioRxiv - Genomics 2022Quote: ... Another half of the genomic DNA (less than 8 ng/μL) was treated with 0.2 unit/μL MseI (NEB, R0525S) for 1 hour at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5ul of PCR1 product as template was amplified using unique i5 and i7 index primer combinations with 8 cycles and Q5 High-Fidelity DNA Polymerase (NEB) for each individual sample to allow pooling of sequencing libraries ...
-
bioRxiv - Molecular Biology 2021Quote: ... 8 μg of digested nucleic acids were treated or not with 10 μl of RNase H (New England BioLabs, M029L) overnight at 37 °C in 1x RNAse H buffer and 1/10 of the samples were used as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 8 ug of <200nt RNA per sample was mixed to an equal volume of 2x loading dye (NEB #B0363A) and incubated at 70°C for 5min ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Physiology 2020Quote: ... RNA with RIN>8 was used to prepare transcriptomic libraries using the NEBNext Ultra RNA library prep kit (New England Biolabs). High throughput RNA-Sequencing was performed at the NIDDK Genomic Core Facility (NIH ...
-
bioRxiv - Biophysics 2019Quote: ... gels were gently removed from the chamber and digested overnight at 37 °C in 8 units mL−1 Proteinase K (NEB) diluted in digestion buffer (1× TAE buffer ...
-
bioRxiv - Physiology 2019Quote: ... Qualifying samples (samples with RNA integrity numbers > 8) were then prepared following the standard protocol for the NEBnext Ultra ii Stranded mRNA (New England Biolabs). Sequencing was performed on the Illumina NextSeq 500 with Paired End 42bp × 42bp reads ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM CaCl2 was added and the His8 tag was cleaved through the addition of 8-16 U/mL enterokinase (New England Biolabs) for 2 days at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified DNA was resuspended in 10 mM Tris pH 8 and prepared for sequencing using the NEBNext Ultra II DNA library kit for Illumina (New England Biolabs). Paired-end sequencing with 75 cycles and a 6-cycle index read was performed on the Illumina NextSeq500 system.
-
bioRxiv - Cancer Biology 2020Quote: ... 30 ng total RNA (RQI≥8) was used for library preparation following the NEBNext Ultra RNA Library Prep Kit for Illumina protocol (New England BioLabs) with the Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2022Quote: Samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8, 50 mM NaCl, 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 8-16 hours at 55°C ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...