Labshake search
Citations for New England Biolabs :
4401 - 4450 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The product was purified with a Monarch PCR and DNA cleanup kit (NEB, T1030) and restricted with enzymes Nde1 (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760S, New England Biolabs) was used to prepare the sequencing libraries ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) as described by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... The transcribed mRNA was purified using Monarch RNA Cleanup Kits (NEB, Cat. No. T2040L) and kept in - 20 until further use.
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA immunoprecipitations and inputs were converted to cDNA using LunaScript RT SuperMix Kit (NEB). m6A-immunoprecipitated samples were normalised to their respective input samples and m6A content at a particular region calculated relative to an unmodified control region within the same transcript.
-
bioRxiv - Genetics 2023Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The domain swap constructs were assembled using the NEBuilder HiFi DNA assembly kit (NEB). Briefly ...
-
bioRxiv - Microbiology 2022Quote: We introduced single point mutants using the Q5® Site-Directed Mutagenesis kit (NEB). Primers containing the mutation amplified the entire CIp10–GPR1–mTurquoise2 plasmid and were confirmed through sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabsⓇ Inc., MA, USA) was preferred in order to select aggregation inhibitory peptide selection ...
-
bioRxiv - Microbiology 2023Quote: ... USA] or the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Plasmid assembly was conducted using NEBuilder HiFi DNA Assembly cloning kit (NEB, cat # E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length PCR product was purified using Monarch Gel Extraction Kit (NEB #T1020), according to manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... and the plasmids were extracted via NEB Monarch Plasmid mini-prep kit (NEB T1010). Plasmid concentrations were measured spectrophotometrically at 260 nm via a Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Point mutations were introduced using the Q5 Site-Directed Mutagenesis kit (New England Biolabs). pET41b+_Ufd1-His6 (#117107) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Cat# E7765) was used to generate sequencing libraires from 1 μg of total RNA ...
-
bioRxiv - Bioengineering 2023Quote: ... and sequencing libraries were prepared using a NEBNext Ultra II kit (NEB, catalog E7645L). Samples were sequenced with 50-bp paired-end reads on an Illumina NextSeq at a depth of 30 million reads per sample ...
-
bioRxiv - Genomics 2023Quote: Individual libraries were constructed using NEBNext Ultra II Directional Prep Kit for Illumina (NEB #7760 ...
-
bioRxiv - Genetics 2023Quote: ... Reactions were performed using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L) and a CFX Opus 384 Real-Time PCR System (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... RNA targets were purified with Monarch® RNA Cleanup Kit (T2040L, New England BioLabs).
-
bioRxiv - Cell Biology 2023Quote: MiRNA sequencing libraries were prepared using NEBNext smallRNA library prep kit (NEB, MA, USA). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... or the Monarch RNA Cleanup Kit (500 μg) (New England BioLabs, cat. no. T2050L). Samples were eluted in a nuclease-free duplex annealing buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with NEBNext Ultra II Directional RNA library prep Kit (NEB#E7760) and NEBNext rRNA Depletion Kit (NEB#E6310 ...
-
bioRxiv - Molecular Biology 2023Quote: ... NGS libraries were pooled and quantified by qPCR using NEBNext Library Quant Kit (NEB). Sequencing was performed with NextSeq high-output kit with 75/150-cycle single-end reads and automated adaptor trimming and demultiplexing (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... and used for library preparation using NEBNext Ultra Library Preparation Kit (New England Biolabs) and sequenced on an Illumina MiSeq (250bp paired-end).
-
bioRxiv - Neuroscience 2023Quote: ... ∼100 ng of RNA was treated with NEBNext rRNA Depletion Kit (New England Biolabs). RNA-Seq was performed using libraries prepared with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reverse-transcription (RT) reactions were performed with 2X LunaScript RT SuperMix Kit (NEB) with 5 μL of RNA input (250 ng of RNA total ...
-
bioRxiv - Microbiology 2023Quote: ... Active site mutant plasmids were assembled using the Q5 Site-Directed Mutagenesis Kit (NEB). Site-directed mutagenesis reactions were transformed into chemically competent NEB5α or DH5α λpir cells and candidate transformants were selected using kanamycin ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from cell pellets using the Monarch gDNA Purification Kit (NEB). 2 µg of purified genomic DNA was then bisulfite converted using the EpiTect Bisulfite Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion was performed using the NEBNext rRNA Depletion Kit for bacteria (NEB) and directional cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... NS5A mutations were constructed using Q5 Site-Directed Mutagenesis Kit (New England BioLabs; E0554S). For E ...
-
bioRxiv - Plant Biology 2023Quote: ... The Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Cat # E3005X) and reaction protocol (cycle variations ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB, E7645S), and sequenced for 50-nt SE reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB), Illumina NGS libraries were prepared using the NEBNext Ultra II DNA Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using the Monarch PCR and DNA Clean Up Kit (#T1030L, NEB) and ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (E7546S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of IVT mRNA was conducted using the Monarch RNA Cleanup Kit (NEB #T2040L). To confirm IVT mRNA were of the correct lengths ...
-
bioRxiv - Neuroscience 2023Quote: ... the DNA was extracted by using Monarch® Genomic DNA Purification Kit (NEB, T3010S). For the analysis of microdeletions of the targeted exons an Out-Fwd (p1 GCACAGTCAGACCACAGTCACC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted using either Monarch Total RNA Miniprep Kit (New England Biolabs) or Direct-zol™ RNA MiniPrep kit (Zymo Research ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7490S and #E7760S) was used to construct sequencing libraries following the manufacturer’s guidelines with one alteration ...
-
A laboratory framework for ongoing optimisation of amplification based genomic surveillance programsbioRxiv - Genomics 2023Quote: ... cDNA was generated for all samples using LunaScript RT SuperMix Kit (New England BioLabs). Sufficient volume was prepared to perform serial dilutions (10−2 to 10 -7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were inserted into this vector using the Gibson Assembly Cloning Kit (New England BioLabs). The final constructs were linearized using the KpnI restriction enzyme (Promega ...
-
bioRxiv - Genetics 2023Quote: ... Cloning was conducted using the NEBuilder HiFi DNA Assembly cloning kit (NEB, no. E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... ChIP libraries were prepared by NEBNext ultra II DNA library preparation kit (NEB E7645L) and sequenced on one lane of a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2023Quote: Cells were lysed and RNA extracted using the Monarch Total RNA Miniprep Kit (NEB) or RNA cleanup kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: Coupled transcription-translation assays were carried out with the PURExpress kit (New England BioLabs) as described in (Lukasiewicz and Contreras ...
-
bioRxiv - Genomics 2023Quote: ... sgRNA was synthesized using NEB’s HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). For generation of transgenic fish ...