Labshake search
Citations for New England Biolabs :
4351 - 4400 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was achieved using the NEBNext rRNA depletion kit v2 (NEB, Cat# E7400L), and subsequent end-repair ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Microbiology 2024Quote: ... The purified products were quantified using the NEBNext Library Quant kit for Illumina (NEB) and sequenced using a mid-output reagent cartridge with 2×150 paired-end reads on an Illumina Miniseq platform ...
-
bioRxiv - Microbiology 2024Quote: ... cells were lysed and RNA purified using the Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer’s instructions except that the on-column DNase treatment was omitted ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library prep kit (New England Biolabs) following manufacturer’s instructions for H3K9ac CUT&RUN DNA ...
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid was blunted by digestion with Quick Blunting™ Kit (NEB, USA) and ligated to re-circularize the plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted using the Monarch Total RNA miniprep kit (New England Biotechnologies (NEB) #T2010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the library for sequencing was constructed with FS DNA Library Prep Kit (NEB, E7805) by following the manual instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA (>300 ng) was reverse transcribed using the Lunascript RT Supermix Kit (NEB, E3010).
-
bioRxiv - Developmental Biology 2024Quote: ... and then immediately followed by Library prep using NEBNext Ultra II kit (NEB, E7770). Libraries were pooled and sequenced using a H75 kit from Illumina in a NextSeq500 sequencer following manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting RNA was purified using the Monarch RNA cleanup kit (New England Biolabs) and analyzed by agarose gel electrophoresis.
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using NEBNext® kit for Illumina® (New England Biolabs, E7630S), pooled at equimolar amounts ...
-
bioRxiv - Cell Biology 2023Quote: ... All amplified fragments were then combined using Gibson assembly (Gibson assembly cloning kit, NEB) with 20 base pair overhangs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted first using a Monarch® Total RNA Miniprep Kit (NEB T2010) with on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: Deletion of vpr was achieved using Q5 Site-Directed Mutagenesis kit (New England Biolabs) where the majority of the vpr coding sequence was deleted using PCR exclusion (forward - CAGAATTGGGTGTCGACATAG ...
-
bioRxiv - Synthetic Biology 2024Quote: ... while Gibson assembly reactions used the NEBuilder(R) HiFi DNA Assembly Cloning Kit (NEB). Transformed bacteria were grown for 24h at 32°C ...
-
bioRxiv - Zoology 2023Quote: ... or the Genome Institute of Singapore (GIS) using NEBNext DNA Library Preparation Kits (NEB). Paired-end sequencing was performed on Illumina Miseq (2x300-bp or 2x250-bp ...
-
bioRxiv - Immunology 2024Quote: ... Gibson assembly was performed using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). 100 ng/μl of pET770 was co-injected along with a body wall muscle co-injection marker (17 ng/μl ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesis was performed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB). One microliter of oligo d(T)23VN primer (50 μM ...
-
bioRxiv - Genetics 2024Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Genomics 2024Quote: The ligation product was purified using a Monarch PCR & DNA Cleanup Kit (NEB #T1030) following the manufacturer’s recommended protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... pBBR1-E and pBBR-EV were extracted using Monarch Plasmid Miniprep kit (#T1010; NEB) and following supplier’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and converted into Illumina sequencing libraries with the NEBNext Small RNA Library kit (NEB). Libraries were sequenced on the Illumina NextSeq-550 in the Boston University Microarray and Sequencing Core ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragments were joined together using Gibson assembly kit (NEB Cat. No. E2611L) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Metagenomic libraries were prepared using the NEB Ultra II kit (NEB; Cat. No. E7645L) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... All disease variants were introduced using a Q5 site-directed mutagenesis kit (NEB, E0554S).
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina HiSeq X Ten or Nova-seq instruments ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the NEB Monarch Total RNA Miniprep Kit (#T2010, New England Biolabs, United Kingdom) respectively ...
-
bioRxiv - Biochemistry 2024Quote: All PCR was performed with Q5 High-Fidelity DNA Polymerase kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... the collected cell pellets were processed using Monarch RNA extraction kit (New England BioLabs). The RNA samples were then quantified with nanodrop and normalized before cDNA synthesis (Lambda Biotechnologies) ...
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, E2040S), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NEB Next® Ultra RNA Library Prep Kit for Illumina (E7530L, NEB, USA) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA libraries were prepared using NEB UltraII RNA library Prep kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was depleted of rRNA using the Illumina rRNA Depletion Kit (NEB #E6310) and then prepared for Illumina sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina #E7760 per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Small RNA libraries were prepared using the NEBNext Small RNA Library Prep kit (NEB), with some modifications ...
-
bioRxiv - Systems Biology 2023Quote: ... rRNA depletion was performed with the NEBNext rRNA Depletion Kit v2 (New England Biolabs), and total RNA libraries were prepared with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) as described by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... The transcribed mRNA was purified using Monarch RNA Cleanup Kits (NEB, Cat. No. T2040L) and kept in - 20 until further use.
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA immunoprecipitations and inputs were converted to cDNA using LunaScript RT SuperMix Kit (NEB). m6A-immunoprecipitated samples were normalised to their respective input samples and m6A content at a particular region calculated relative to an unmodified control region within the same transcript.
-
bioRxiv - Genetics 2023Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The domain swap constructs were assembled using the NEBuilder HiFi DNA assembly kit (NEB). Briefly ...
-
bioRxiv - Microbiology 2022Quote: We introduced single point mutants using the Q5® Site-Directed Mutagenesis kit (NEB). Primers containing the mutation amplified the entire CIp10–GPR1–mTurquoise2 plasmid and were confirmed through sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabsⓇ Inc., MA, USA) was preferred in order to select aggregation inhibitory peptide selection ...