Labshake search
Citations for New England Biolabs :
4251 - 4300 of 5199 citations for 4 2 Hydroxy 1 Methoxyethyl 1 2 Benzenediol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: 1 µl of DMS-modified RNA was reverse transcribed in 20 µl using Induro Reverse Transcriptase (New England Biolabs) according to the manufacturer’s protocol with 500 nM of primer CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.81 nmol LbCas12U protein and 0.45 nmol of each of three crRNAs were assembled in 1 x Nuclease Reaction Buffer (NEB). Protein and crRNAs were mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were split into two equal samples and incubated at 50°C for 25 minutes with exonuclease 1 (NEB, M0293) to remove unintegrated barcoded transposon adapters ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg mL−1 BSA at pH 7.9; New England Biolabs). The reactions were incubated at 37 °C for 20-45 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The pellet was resuspended in 3 μL of 1 mM NaOAc pH 5.2 and immediately added to a PURExpress (ΔtRNA, Δaa) (New England Biolabs) reaction containing 2.5 μL solution A ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All reactions were then digested with 1 µl ExoI and purified using the Monarch DNA Gel Extraction Kit (NEB), eluting in 10 µl of elution buffer (10 mM Tris•Cl pH 7.4) ...
-
bioRxiv - Microbiology 2024Quote: ... the pCDFDuet-1 vector was linearized via PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs, NEB) with primers listed in Supplementary Table 10 ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were euthanized with ice and digested in 100 µL TE buffer with 1 µL ProK (New England Biolabs). They were then genotyped by PCR and Sanger sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: Conventional PCR was conducted using plasmids of Sfla Or42a3 as backbone (Q5 DNA polymerase, #M0491, NEB; Supplemental File 1). Primers were designed to introduce the point mutations (Supplementary File 1) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA from each phosphatase or control reaction was then used to set up two reactions 20 μL reactions containing 1 μg of treated RNA in NEBuffer 3.1 (New England Biolabs) with or without the addition of 1 μL (1U ...
-
bioRxiv - Microbiology 2024Quote: ... the pCDFDuet-1 vector was linearized via PCR using Q5® High-Fidelity DNA Polymerase (New England Biolabs, NEB) with primers listed in Supplementary Table 10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis was performed in 20 µl at 42°C for 1 h using AMV reverse transcriptase (NEB, M0277), and 5 µl of the RT reaction was amplified in 25 µl using AccuPrime Pfx DNA polymerase (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were washed three times prior to labeling by incubation in 1 µM BG-Alexa-546 (New England BioLabs) in EX for 20 min at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... samples were digested by incubation in reverse-crosslinking buffer (50 mM Tris pH 8.0, 50 mM NaCl and 0.2% SDS) with 1:50 proteinase K (NEB P8107S) for 30 min at 55 °C in the dark ...
-
bioRxiv - Genomics 2024Quote: ... the RT product was digested overnight at 37°C with 1 unit of USER Enzyme (New England Biolabs, M5505L) per µg of product ...
-
bioRxiv - Bioengineering 2024Quote: ... GTP was added to a final concentration of 2 mM along with a buffer including magnesium (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH = 7.5; New England Biolabs) into circRNA solution ...
-
bioRxiv - Biophysics 2024Quote: ... 800 μL of 2 M MgCl2 and 1.6 mL 1 M CaCl2 were added to the lysed cells along with 2.5 μL DNase (New England Biolabs) and OmniCleave endonuclease (Biosearch Technology ...
-
bioRxiv - Immunology 2024Quote: ... Reverse transcription was then performed with 0,5-1 μg of RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) and 3′-RACE CDS primer (Clontech) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1–5 μg of plasmid was linearized prior to transformation using either ScaI-HF or EcoRI-HF (both NEB), respectively ...
-
bioRxiv - Genomics 2024Quote: ... We performed PCR reactions using 1 ng of the pooled gRNA library plasmids per reaction with Q5 polymerase (NEB). The correct size band from the PCR product was then gel-purified from a 2% E-gel EX (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... the PCR product was digested overnight at 37°C with 1 unit of NheI-HF (New England Biolabs, R3131) per µg of product ...
-
bioRxiv - Cell Biology 2024Quote: ... SNAP-tagged GLP-1R was detected with an anti-SNAP tag rabbit polyclonal antibody (1:500; New England Biolabs) followed by goat anti rabbit IgG HRP (1:2,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR products and the backbones pLL3.7m-mTurquoise2-SLBP and pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt were cut with MluI-HF (NEB, R3198S), followed by dephosphorylation with rSAP (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the primers (YH146 and YH 147, see Supplemental Table 1) and Q5 High-Fidelity DNA Polymerase (NEB, M0491L). The insertion sequences were cloned from pgLAP5-CRYS-ARL13B-bPAC-EGFP plasmid (gift from Dr ...
-
bioRxiv - Genetics 2024Quote: ... 1 μg of total RNA or 18S rRNA was degraded to single nucleotides using Nucleoside Digestion Mix (NEB #M0649), followed by the addition of a 4-fold volume of methanol and precipitation at −20°C for 2 hours to remove proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA was synthesized from 1 µg of total RNA using ProtoScriptR II Reverse Transcriptase (New England BioLabs, MA, USA) in 20 µl reaction with oligo (dT ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and +1 sites of the promoters controlling transcription of both RNAs were used to amplify the standard pUC19 plasmid (NEB). After PCR amplification samples were digested with DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA resin elute was immediately diluted with PBS containing 1 mM EDTA (PBS-E) and incubated with amylose resin (New England Biolabs) for 30 min ...